Organism : Rhodobacter sphaeroides 2.4.1 | Module List:
Module 57 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 57

There are 15 regulatory influences for Module 57

Regulator Table (15)
Regulator Name Type
RSP_0768 tf
RSP_3324 tf
RSP_2130 tf
RSP_2939 tf
RSP_0032 tf
RSP_2681 tf
RSP_0601 tf
RSP_2730 tf
RSP_1866 tf
RSP_3620 tf
RSP_1669 tf
RSP_0927 tf
RSP_2591 tf
RSP_2171 tf
RSP_1952 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
7834 6.30e-08 aaaAAAtCgG
Loader icon
7835 5.90e+00 ATCTATGCCCTTTGTGATATATA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 57 is enriched for following functions.

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Metabolism cog category 3.63e-03 6.12e-03 15/26
Poorly characterized cog category 2.28e-03 3.92e-03 10/26
Amino acid transport and metabolism cog subcategory 5.50e-05 1.46e-04 9/26
General function prediction only cog subcategory 4.11e-04 8.19e-04 8/26
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 57

There are 26 genes in Module 57

Gene Member Table (26)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
RSP_0341 RSP_0341 CDS None chromosome 1 2071291 2072568 - Cytosine deaminase (NCBI) False
RSP_0342 RSP_0342 CDS None chromosome 1 2072568 2073515 - putative ABC sugar transporter, inner membrane subunit (NCBI) False
RSP_0343 RSP_0343 CDS None chromosome 1 2073607 2074650 - putative ABC sugar transporter, inner membrane subunit (NCBI) False
RSP_0344 RSP_0344 CDS None chromosome 1 2074640 2076160 - putative ABC sugar transporter, fused ATPase subunits (NCBI) False
RSP_0347 RSP_0347 CDS None chromosome 1 2078687 2079568 + ABC transporter, inner membrane subunit (NCBI) False
RSP_0348 RSP_0348 CDS None chromosome 1 2079565 2080356 + ABC transporter, inner membrane subunit (NCBI) False
RSP_0805 DppC CDS None chromosome 1 2548893 2549795 - ABC dipeptide transporter, inner membrane subunit DppC (NCBI) False
RSP_0889 glnK CDS None chromosome 1 2637879 2638217 - Nitrogen regulatory protein P-II (NCBI) False
RSP_2090 pycA CDS None chromosome 1 684379 687843 - Pyruvate carboxylase (NCBI) False
RSP_2158 RSP_2158 CDS None chromosome 1 761705 762802 - ABC transporter, periplasmic solute-binding protein (NCBI) False
RSP_3037 RSP_3037 CDS None chromosome 2 71772 72530 - Putative short-chain dehydrogenase/reductase (NCBI) False
RSP_3038 RSP_3038 CDS None chromosome 2 72551 73354 - ABC permidine/putrescine transporter, inner membrane subunit (NCBI) False
RSP_3039 RSP_3039 CDS None chromosome 2 73363 74214 - ABC permidine/putrescine transporter, inner membrane subunit (NCBI) False
RSP_3040 RSP_3040 CDS None chromosome 2 74227 75384 - ABC permidine/putrescine transporter, periplasmic substrate-binding protein (NCBI) False
RSP_3041 RSP_3041 CDS None chromosome 2 75444 76541 - ABC permidine/putrescine transporter, ATPase subunit (NCBI) False
RSP_3042 dorX CDS None chromosome 2 76617 77390 + DMSO reductase regulatory protein DorX (NCBI) True
RSP_3248 RSP_3248 CDS None chromosome 2 304951 306462 - ABC peptide transporter, periplasmic binding protein (NCBI) False
RSP_3381 RSP_3381 CDS None chromosome 2 444827 445801 - NAD(P)H -dependent quinone oxidoreductase (NCBI) False
RSP_3382 RSP_3382 CDS None chromosome 2 445798 446205 - hypothetical protein (NCBI) False
RSP_3383 RSP_3383 CDS None chromosome 2 446249 447067 - hypothetical protein (NCBI) False
RSP_3513 RSP_3513 CDS None chromosome 2 592286 593266 + GAF sensor diguanylate cyclase (NCBI) False
RSP_3687 RSP_3687 CDS None chromosome 2 808643 809575 + ABC sugar transporter, periplasmic binding protein (NCBI) False
RSP_3688 RSP_3688 CDS None chromosome 2 809572 810357 + ABC sugar transporter, ATPase subunit (NCBI) False
RSP_3689 yphD CDS None chromosome 2 810357 811361 + ABC sugar transporter, inner membrane subunit (NCBI) False
RSP_3691 RSP_3691 CDS None chromosome 2 812445 813209 + putative cytoplasmic protein (NCBI) False
RSP_3758 RSP_3758 CDS None chromosome 2 885800 887131 - Cytosine-specific DNA methylase (NCBI) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 57

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.