Organism : Desulfovibrio vulgaris Hildenborough | Module List:
Module 60 Profile

GeneModule member RegulatorRegulator MotifMotif
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 60

There are 10 regulatory influences for Module 60

Regulator Table (10)
Regulator Name Type
DVU2557
DVU2547		 combiner
DVU2547
DVU2251		 combiner
DVU1144 tf
DVU0110
DVU1419		 combiner
DVU2909
DVU1949		 combiner
DVU3084
DVU1419		 combiner
DVU2788
DVU2394		 combiner
DVU1949 tf
DVU2788
DVU2557		 combiner
DVU2557
DVU1419		 combiner

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.
Click on the RegPredict links to explore the motif in RegPredict.

Motif Table (2)
Motif Id e-value Consensus Motif Logo RegPredict
117 2.80e+02 ACATAGAGAGAGGTTACAAAAGAT
Loader icon
 RegPredict
118 2.50e+02 aTgtacggGaAaAtcCacA
Loader icon
 RegPredict
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 60 is enriched for following functions.

KEGG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini Hochberg pvalue Genes with function Method
Carbohydrate Metabolism kegg subcategory 2.30e-05 4.94e-04 8/29
Metabolism kegg category 8.55e-04 7.53e-03 14/29
Carbohydrate Metabolism kegg subcategory 3.23e-03 1.35e-02 4/29

GO Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
electron transport biological_process 1.30e-02 2.00e-02 4/29
electron carrier activity molecular_function 5.53e-03 8.91e-03 3/29

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Metabolism cog category 2.23e-02 3.59e-02 11/29
Energy production and conversion cog subcategory 2.68e-02 4.25e-02 4/29
Carbohydrate transport and metabolism cog subcategory 6.48e-03 1.15e-02 3/29
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 60

There are 29 genes in Module 60

Gene Member Table (29)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
DVU0019 ngr CDS 2794280 chromosome 22502 23110 - nigerythrin False
DVU0276 CDS 2795067 chromosome 319404 319802 - hypothetical protein DVU0276 False
DVU0423 CDS 2795216 chromosome 478518 478943 + universal stress protein False
DVU0490 CDS 2793704 chromosome 558218 559487 - None False
DVU0565 gap-1 CDS 2795890 chromosome 630087 631103 - glyceraldehyde 3-phosphate dehydrogenase False
DVU0566 CDS 2795891 chromosome 631123 631680 - GAF domain-containing protein False
DVU0773 CDS 2794844 chromosome 864023 864262 + hypothetical protein DVU0773 False
DVU0881 fusA CDS 2795135 chromosome 971471 973537 - elongation factor G False
DVU0882 CDS 2795136 chromosome 973743 974207 + hypothetical protein DVU0882 False
DVU0883 CDS 2795137 chromosome 974481 974738 + glutaredoxin False
DVU0974 CDS 2795106 chromosome 1070600 1070938 + hypothetical protein DVU0974 False
DVU0979 CDS 2795111 chromosome 1074581 1075645 + dihydroxyacetone kinase subunit DhaK False
DVU0995 CDS 2794152 chromosome 1088648 1089235 + ThiJ/PfpI family protein False
DVU1283 galU CDS 2794349 chromosome 1375922 1376800 + UTP-glucose-1-phosphate uridylyltransferase False
DVU1397 bfr CDS 2794797 chromosome 1466087 1466626 - bacterioferritin False
DVU1422 CDS 2794683 chromosome 1495381 1496454 - OmpA family protein False
DVU1528 CDS 2793813 chromosome 1596516 1597001 - cytidine/deoxycytidylate deaminase family protein False
DVU1529 CDS 2793814 chromosome 1597222 1597878 - decarboxylase False
DVU1541 CDS 2793691 chromosome 1607951 1608352 - hypothetical protein DVU1541 False
DVU2212 CDS 2795359 chromosome 2309563 2309925 + hypothetical protein DVU2212 False
DVU2349 CDS 2795523 chromosome 2442630 2445197 + carbohydrate phosphorylase family protein False
DVU2427 CDS 2794368 chromosome 2531790 2532431 - hypothetical protein DVU2427 False
DVU3042 CDS 2796460 chromosome 3165553 3165789 + lipoprotein False
DVU3183 rbO CDS 2793833 chromosome 3343927 3344307 + desulfoferrodoxin False
DVU3184 CDS 2793834 chromosome 3344324 3344482 + rubredoxin False
DVU3185 roO CDS 2793835 chromosome 3344614 3345822 + rubredoxin-oxygen oxidoreductase False
DVU3293 CDS 2796017 chromosome 3469747 3471390 + acetolactate synthase False
DVU3355 CDS 2795669 chromosome 3526649 3527404 + SPFH domain-containing protein/band 7 family protein False
DVU3392 glnA CDS 2796411 chromosome 3567474 3568817 + glutamine synthetase, type I False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.