Module 222

Summary

Residual Gene Count Condition Count 1st Q Condition Block * 5th Q Condition Block *
0.51 18 64 In vivo vs. In vitro NA

Bicluster expression profile

Expression of genes in subset of conditions included in bicluster on left side of red dashed line and out of bicluster on right of red dashed line. Each condition is represented as a boxplot, ordered by their median expression for the bicluster genes (smallest to largest) and colored according to condition blocks.

Boxplot test

Gene expression profiles across conditions are sorted as on the left and broken into quintiles following the dashed grey lines. Then each quintile is tested for enrichment of each condition by using hypergeometric test. The deviation from zero indicates over-enrichment.

Boxplot test

Conditions

codY knockout

codY knockout

Integration of metabolism and virulence by Clostridium difficile CodY

Series: GSE23192 | Pubmed ID: 20709897 | Type: Expression profiling by array

Summary:CodY, a global regulatory protein that monitors the nutrient sufficiency of the environment by responding to the intracellular levels of GTP and the branched-chain amino acids, was previously shown to be a potent repressor of toxin gene expression in Clostridium difficile during growth in rich medium. In the intestinal tract, such derepression of toxin synthesis may lead to destruction of epithelial cells and the liberation of potential nutrients for the bacterium. CodY is likely to play an important role in regulating overall cellular physiology as well. In this study, DNA microarray analysis and affinity purification of CodY-DNA complexes were used to identify and distinguish the direct and indirect effects of CodY on global gene transcription. A codY null mutation resulted in >4-fold overexpression of 146 genes (organized in 82 apparent transcription units) and underexpression of 19 genes. In addition to the toxin genes, genes for amino acid biosynthesis, nutrient transport, fermentation pathways, membrane components and surface proteins were overexpressed in the codY mutant. Genome-wide analysis identified more than 350 CodY binding regions, many of which are likely to correspond to sites of direct CodY-mediated regulation. About 60% of the CodY-repressed transcription units were associated with binding regions. Several of these genes were confirmed to be direct targets of CodY by gel mobility shift and DNase I footprinting assays.

Overall Design:The experiment was designed to compare gene expression in codY+ and codY mutant strains grown to mid-exponential phase. Three two-color arrays, representing three biological replicates. Each array compares two strains: JIR8094 (pSD21) and JIR9084::pSD21.

Samples: GSM570801, GSM570802, GSM570803

In vivo vs. In vitro

In vivo vs. In vitro

Comparison of the expression profiles of the 630E strain after 8h, 14h and 38h of infection in mouse

Series: GSE43303,GSE43305 | Pubmed ID: 23897605 | Type: Expression profiling by array

Summary:The virulence factors of Clostridium difficile have been studied for many years, but the main in vivo pathogenesis processes of this bacterium has to be investigated. Especially, data on the early mechanisms of C. difficile adaptation to the host is not yet available. The objective of our study was to improve the understanding of the pathogenesis of C. difficile by the analysis of the genome-wide temporal expression of C. difficile genes during the first hours of infection. Three groups of 4 axenic mice each were challenged by vegetative cells of the 630 C. difficile strain, and sacrified at 8, 14, and 38 hours post-infection. Pure prokaryotic RNA was obtained from caecal bacteria. Comparative hybridizations on strain 630 microarrays were done using cDNA issued from an 8-hours in vitro culture as control, with a dye-swap protocol for each sample. Normalisation and statistical analysis of all data were done with different functions of the limma package. The pathogenesis of C. difficile could be seen as a result of the successful metabolic adaptation of the bacteria to its host, contributing to its persistence and multiplication, and the coordinate expression of virulence factors. Analysis of our data enlightened some of these aspects. The results support strongly a two-step infection model, since there is, during the course of infection, a significant increase in the toxins expression contrasting with a decreased expression of most of the putative colonization factors. Several paralogs of the HMW S-layer protein are also down-regulated, some of them could be strong candidates as colonisation factors. Bacterial adaptation to the microenvironment of the host is assessed by the regulation of numerous metabolic pathways, i.e., the upregulation of the ethanolamine catabolic operon or the modulation of several PTS systems. Inactivation of some putative virulence factors identified by this methodology will complete this analysis.

Overall Design:Transcriptional profiling of the C. difficile 630E strain after 8h, 14h or 38h of infection in mouse.; Three-condition experiments: 630E strain 8h, 14h or 38h of infection in mouse vs. 630E strain 8h in culture. 4 biological replicates for each condition in dye swap.

Samples: GSM1060320, GSM1060321, GSM1060322, GSM1060323, GSM1060324, GSM1060325, GSM1060326, GSM1060327, GSM1060328, GSM1060329, GSM1060330, GSM1060331, GSM1060332, GSM1060333, GSM1060334, GSM1060335, GSM1060336, GSM1060337, GSM1060338, GSM1060339, GSM1060340, GSM1060341, GSM1060342, GSM1060343, GSM1060344, GSM1060345, GSM1060346, GSM1060347, GSM1060348, GSM1060349, GSM1060350, GSM1060351

Early infection

Early infection

Transcription profiling of Caco-2 cells and Clostridium difficile during infection

Series: GSE18407 | Pubmed ID: 20521945 | Type: Expression profiling by array

Summary:Clostridium difficile is an anaerobic spore-forming rod-shaped gram-positive bacterium that can infect both humans and animals. Most studies on the pathogenesis of C. difficile have focused on its toxins and their effect on the host cells. Recently, we utilized microarrays to identify conserved and divergent genes associated with virulence in C. difficile isolates from humans and animals. Our data provided the first clue toward a complex mechanism underlying host adaptation and pathogenesis. Microarray technology offers an efficient high-throughput tool to study the transcriptional profiles of pathogens and infected host cells. Transcriptomes of C. difficile after exposure to environmental and antibiotic stresses and those of human epithelial colorectal Caco-2 cells upon TcdA treatment have been analyzed. To our knowledge, there are still no reports on the transcriptomic study of host-pathogen interactions for C. difficile infection (CDI). In vitro analyses of interplay between host and pathogen are essential to unravel the mechanisms of infection and to investigate the host response to infection. We therefore employed microarrays to study both bacterial and human cellular transcriptome kinetics during CDI to Caco-2 cells. Here we present a large-scale analysis of transcriptional profiles to reveal molecular determinants playing a role in C. difficile pathogenesis and the host response. We found that there were 254 and 224 differentially-expressed genes after CDI in C. difficile and Caco-2 cells, respectively. These genes are clustered according to their functional categories and their potential roles in pathogenesis and host response are discussed. Our results will not only increase our understanding on the host-pathogen interaction, but may also provide targets for drug development.

Overall Design:Clostridium difficile: Control vs Infection (time course); mRNA with genomic DNA of tested and reference strains; ; Caco-2 cells: Control vs Infected with Clostridium difficile; Time-course experiments of Caco-2 cells infected with C. difficile for 30, 60 and 120 min

Samples: GSM458943, GSM458942, GSM458941, GSM458940, GSM458939, GSM458938, GSM458937, GSM458936, GSM458935, GSM458934, GSM458933, GSM458932

Rich vs poor diet

Rich vs poor diet

The in vivo responses elicited by Clostridium difficile in response to the gut commensal B. thetaiotaomicron and diet

Series: GSE60751 | Pubmed ID: | Type: Expression profiling by array

Summary:Analysis of Clostridium difficile (Cd) from the cecal contents of germ-free mice or Bacteroides thetaiotaomicron (Bt)-monocolonized mice on a standard, polysaccharide rich diet or polysaccharide deficient diet 5 days after infection. Results identify genes that are involved in the Cd response to diet, in vivo colonization and in interactions with Bt.

Overall Design:In vitro transcriptional profiles of Clostridium difficile obtained from cecal contents of germ-free or Bt-monocolonized mice on a standard, polysaccharide rich or polysaccharide deficient diet. 4 samples/group. 2 control genomic DNA samples for Clostridium difficile and 2 reference genomic DNA samples for Bacteroides thetaiotaomicron; ; Please note that 4 control samples (genomic DNA) were used to determine whether the genomic DNA correctly bound to the probes and thus, were not included in data processing (i.e no processed/normalized data).

Samples: GSM1487085, GSM1487086, GSM1487087, GSM1487088, GSM1487089, GSM1487090, GSM1487092, GSM1487091

fur knockout

fur knockout

Expression analysis of Clostridium difficile wild type and fur (ferric uptake regulator) mutant in high iron.

Series: GSE69218 | Pubmed ID: | Type: Expression profiling by array

Summary:Investigation of whole genome gene expression level changes in a Clostridium difficile fur (ferric uptake regulator) mutant, compared to the wild type strain 630 erm.; The fur mutant analyzed in this study is further described in Ho and Ellermeier (2015) J. Bacteriology

Overall Design:A microarray study using total RNA recovered from three separate wild type cultures of Clostridium difficile 630 erm strain and three separate cultures of a fur mutant strain (ltrA::ermR) were grown in Tryptone-Yeast Extract medium containing 0.25 mM ferric chloride . Each chip measures the expression level of 3,786 of the 3,787 open reading frames of the C. difficile 630 genome with 18 probes (60 oligomers each) for each gene.

Samples: GSM1695516, GSM1695517, GSM1695518, GSM1695519, GSM1695520, GSM1695521, fur.high.11, fur.high.1.1, fur.high.21, fur.high2.1, fur.high.31, fur.high3.1, fur.low.1, fur.low.2, fur.low2, fur.low.3, fur.low3

Commensal vs germ free

Commensal vs germ free

The in vivo responses elicited by Clostridium difficile in response to the gut commensal B. thetaiotaomicron and diet

Series: GSE60751 | Pubmed ID: | Type: Expression profiling by array

Summary:Analysis of Clostridium difficile (Cd) from the cecal contents of germ-free mice or Bacteroides thetaiotaomicron (Bt)-monocolonized mice on a standard, polysaccharide rich diet or polysaccharide deficient diet 5 days after infection. Results identify genes that are involved in the Cd response to diet, in vivo colonization and in interactions with Bt.

Overall Design:In vitro transcriptional profiles of Clostridium difficile obtained from cecal contents of germ-free or Bt-monocolonized mice on a standard, polysaccharide rich or polysaccharide deficient diet. 4 samples/group. 2 control genomic DNA samples for Clostridium difficile and 2 reference genomic DNA samples for Bacteroides thetaiotaomicron; ; Please note that 4 control samples (genomic DNA) were used to determine whether the genomic DNA correctly bound to the probes and thus, were not included in data processing (i.e no processed/normalized data).

Samples: GSM1487081, GSM1487082, GSM1487083, GSM1487084, GSM1487089, GSM1487090, GSM1487091, GSM1487092

Response to oxygen

Response to oxygen

Clostridium difficile response to oxygen

Series: GSE109175 | Pubmed ID: | Type: Expression profiling by array

Summary:C. difficile was grown in either anaerobic conditions or 2% oxygen and gene expression was compared

Overall Design:C. difficile was grown in either anaerobic conditions or 2% oxygen and gene expression was compared. Two conditions were tested with three replicates each (6 samples total)

Samples: GSM2934766, GSM2934767, GSM2934768

Exponential to stationary phase

Exponential to stationary phase

Metabolic reprogramming with the induction of toxin production of Clostridioides difficile during the stationary phase

Series: GSE115054 | Pubmed ID: | Type: Expression profiling by array

Summary:Systems biology approach of Clostridioides difficile to analyze the temporal changes in the intracellular and extracellular metabolme, transcriptome and proteome along the growth curve in casamino acids medium and the connection to toxin production.

Overall Design:Clostridioides difficile 630∆erm (DSM28645) were grown in a casamino acids medium (CDMM) containing 2 g/L glucose. Samples were taken at five time points along the growth curve (exponential growth: 14.5 h of cultivation, transient phase: 17.25 h, stationary phase 1: 19.25 h, stationary phase 2: 24.25 h, stationary phase 3: 29.25 h). The cultivation was performed with four biological replicates. Reference in transcriptomic acid proteomic measurement was the exponential phase samples.

Samples: GSM3164188, GSM3164189, GSM3164190, GSM3164191, GSM3164192, GSM3164193, GSM3164194, GSM3164195, GSM3164196, GSM3164197, GSM3164198, GSM3164199, GSM3164200, GSM3164201, GSM3164202, GSM3164203

Iron limiting condition

Iron limiting condition

Clostridium difficile response to iron limitation

Series: GSE109453 | Pubmed ID: | Type: Expression profiling by array

Summary:C. difficile was grown in BHIS broth or BHIS broth with 75uM dipridyl and gene expression was compared.

Overall Design:Two conditions were tested at three timepoints with three replicates each (18 samples total).

Samples: GSM2943576, GSM2943577, GSM2943578, GSM2943582, GSM2943583, GSM2943584, GSM2943588, GSM2943589, GSM2943590, WT.high.1, WT.high.2, WT.high.3, fur.high.1, fur.high.2, fur.high2, fur.high.3, fur.high3

de novo identified motifs are listed below

Motif 1 Motif 1 e-value Motif 2 Motif 2 e-value
CAATTAGGGTGGTAACGCGAT 4.6e-16 TCGTCCCTT 0.0000006
Default filter: > 0.1 (Absolute Beta)
No TF influences through Inferelator were found with default filters !
Default filter: < 0.05
Default filter: > 4
No TF influences through hypergeometric test were found with default filters.

The module is significantly enriched with genes associated to the indicated functional terms

Default filter:<= 0.05
Default filter > 4
No functional enrichments were found with default filters.

Genes that are included in this module

* "Gene essentiality is based on TnSeq Data from: Dembek M, Barquist L, Boinett CJ, et al. High-throughput analysis of gene essentiality and sporulation in Clostridium difficile. mBio. 2015;6(2):e02383. Published 2015 Feb 24.doi:10.1128/mBio.02383-14".

Displaying 1 - 18 of 18
Title Short Name Product Function Essentiality * in vivo Essentiality Rich broth Essentiality Expression
CD630_12860 Conserved hypothetical protein
CD630_12830 Conserved hypothetical protein, UPF0297 family
CD630_12850 Putative Holliday junction resolvase Could be a nuclease involved in processing of the 5'-end of pre-16S rRNA.
CD630_07520 ABC-type transport system, aminoacid-familyATP-binding protein
CD630_12840 Putative membrane protein
CD630_07500 ABC-type transport system, aminoacid-familyextracellular solute-binding protein
CD630_07510 ABC-type transport system, aminoacid-familypermease
CD630_12820 alaS Alanyl-tRNA synthetase Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala). Also edits incorrectly charged Ser-tRNA(Ala) and Gly-tRNA(Ala) via its editing domain. Yes
CD630_20320 argB Acetylglutamate kinase Catalyzes the ATP-dependent phosphorylation of N-acetyl-L-glutamate.
CD630_20340 argC N-acetyl-gamma-glutamyl-phosphate reductase Catalyzes the NADPH-dependent reduction of N-acetyl-5-glutamyl phosphate to yield N-acetyl-L-glutamate 5-semialdehyde.
CD630_20300 argF Ornithine carbamoyltransferase (OTCase) Reversibly catalyzes the transfer of the carbamoyl group from carbamoyl phosphate (CP) to the N(epsilon) atom of ornithine (ORN) to produce L-citrulline.
CD630_17850 argG Argininosuccinate synthase (Citrulline--aspartateligase)
CD630_20330 argJ Arginine biosynthesis bifunctional protein ArgJ[Includes: Glutamate N-acetyltransferase ; Amino-acidacetyltransferase] Catalyzes two activities which are involved in the cyclic version of arginine biosynthesis: the synthesis of N-acetylglutamate from glutamate and acetyl-CoA as the acetyl donor, and of ornithine by transacetylation between N(2)-acetylornithine and glutamate.
CD630_20310 argM Succinylornithine transaminase (ACOAT)
CD630_22450 asnC Asparaginyl-tRNA synthetase (Asparagine--tRNAligase) (AsnRS) Yes
CD630_26180 ileS Isoleucyl-tRNA synthetase Catalyzes the attachment of isoleucine to tRNA(Ile). As IleRS can inadvertently accommodate and process structurally similar amino acids such as valine, to avoid such errors it has two additional distinct tRNA(Ile)-dependent editing activities. One activity is designated as 'pretransfer' editing and involves the hydrolysis of activated Val-AMP. The other activity is designated 'posttransfer' editing and involves deacylation of mischarged Val-tRNA(Ile). Yes
CD630_21190 thrB Homoserine kinase (HSK) (HK) Catalyzes the ATP-dependent phosphorylation of L-homoserine to L-homoserine phosphate.
CD630_21180 thrC Threonine synthase
Click to download CSV of this table