Organism : Bacillus subtilis | Module List:
Module 116 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 116

There are 7 regulatory influences for Module 116

Regulator Table (7)
Regulator Name Type
BSU16810 tf
BSU05390 tf
BSU35520 tf
BSU00700 tf
BSU36630 tf
BSU15640 tf
BSU02500 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
5186 1.00e+05 ATCTCTTTAGATGTTAGGTTT
Loader icon
5187 6.40e+00 TC.TtTtTTTa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 116 is enriched for following functions.

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Poorly characterized cog category 7.05e-04 1.32e-03 11/26
General function prediction only cog subcategory 3.30e-02 4.95e-02 5/26
Function unknown cog subcategory 3.46e-03 5.86e-03 6/26
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 116

There are 26 genes in Module 116

Gene Member Table (26)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
BSU05390 ydfF CDS None chromosome 585412 586092 + putative transcriptional regulator (RefSeq) True
BSU08650 fabL CDS None chromosome 936414 937166 + enoyl-(acyl carrier protein) reductase (RefSeq) False
BSU11580 yjbK CDS None chromosome 1235224 1235796 - putative RNA/thiamine triphosphatase (RefSeq) False
BSU11590 yjbL CDS None chromosome 1235921 1236289 + putative phosphatase (RefSeq) False
BSU11600 yjbM CDS None chromosome 1236318 1236953 + (p)ppGpp synthetase (RefSeq) False
BSU13280 ykoJ CDS None chromosome 1394083 1394595 + hypothetical protein (RefSeq) False
BSU13820 ykvT CDS None chromosome 1447814 1448440 + cell wall hydrolase related to spore cortex-lytic enzymes (RefSeq) False
BSU16000 ylqC CDS None chromosome 1673192 1673437 + putative RNA binding protein (RefSeq) False
BSU16800 spoIIIE CDS None chromosome 1751569 1753932 + spore DNA translocase (RefSeq) False
BSU16810 ymfC CDS None chromosome 1754075 1754800 + putative transcriptional regulator (GntR family) (RefSeq) True
BSU17050 mutL CDS None chromosome 1777607 1779490 + DNA mismatch repair protein (RefSeq) False
BSU18990 yobK CDS None chromosome 2070497 2070955 - hypothetical protein (RefSeq) False
BSU19000 yobL CDS None chromosome 2070965 2072767 - putative phage DNA manipulating enzyme (RefSeq) False
BSU19340 yocR CDS None chromosome 2104146 2105483 - putative sodium-dependent transporter (RefSeq) False
BSU21720 ypmT CDS None chromosome 2289274 2289468 - hypothetical protein (RefSeq) False
BSU22910 ypfA CDS None chromosome 2396216 2396869 - putative cyclic diGMP binding protein (RefSeq) False
BSU23760 coaA CDS None chromosome 2467738 2468697 - pantothenate kinase (RefSeq) False
BSU25110 yqfU CDS None chromosome 2591236 2592117 - putative integral inner membrane protein (RefSeq) False
BSU31150 yubB CDS None chromosome 3193674 3194504 - undecaprenyl pyrophosphate phosphatase (RefSeq) False
BSU32330 lipA CDS None chromosome 3319350 3320246 - lipoyl synthase (RefSeq) False
BSU32620 yurQ CDS None chromosome 3351339 3351713 - putative excinuclease (RefSeq) False
BSU35260 ftsE CDS None chromosome 3623851 3624537 - cell-division ABC transporter (ATP-binding protein) (RefSeq) False
BSU38220 ywcC CDS None chromosome 3921315 3921986 - putative transcriptional regulator (RefSeq) True
BSU38360 ywbD CDS None chromosome 3934845 3936035 - putative AdoMet-dependent methyltransferase (RefSeq) False
BSU39550 yxeH CDS None chromosome 4062700 4063512 - putative hydrolase (RefSeq) False
BSU40650 yybG CDS None chromosome 4177315 4178154 + hypothetical protein (RefSeq) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 116

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.