Organism : Bacillus subtilis | Module List :
BSU05390 ydfF

putative transcriptional regulator (RefSeq)

CircVis
Functional Annotations (4)
Function System
Predicted transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU05390
(Mouseover regulator name to see its description)

BSU05390 is regulated by 21 influences and regulates 3 modules.
Regulators for BSU05390 ydfF (21)
Regulator Module Operator
BSU00700 116 tf
BSU02500 116 tf
BSU05390 116 tf
BSU15640 116 tf
BSU16810 116 tf
BSU35520 116 tf
BSU36630 116 tf
BSU03880 94 tf
BSU05120 94 tf
BSU05390 94 tf
BSU05700 94 tf
BSU06580 94 tf
BSU13310 94 tf
BSU18420 94 tf
BSU21780 94 tf
BSU25100 94 tf
BSU27000 94 tf
BSU27120 94 tf
BSU29000 94 tf
BSU30020 94 tf
BSU33650 94 tf

Warning: BSU05390 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5142 7.30e+03 t.Aa.gGaGGa
Loader icon
5143 1.20e+02 AatGtTtTaCAATtaATGTcAT
Loader icon
5186 1.00e+05 ATCTCTTTAGATGTTAGGTTT
Loader icon
5187 6.40e+00 TC.TtTtTTTa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU05390

BSU05390 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Predicted transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for BSU05390

BSU05390 has total of 54 gene neighbors in modules 94, 116
Gene neighbors (54)
Gene Common Name Description Module membership
BSU00440 veg hypothetical protein (RefSeq) 94, 115
BSU03140 tmrB ATP-binding tunicamycin resistance protein (RefSeq) 94, 115
BSU03150 aroK shikimate kinase (RefSeq) 94, 115
BSU03880 yczG putative transcriptional regulator (ArsR family) (RefSeq) 94, 115
BSU05390 ydfF putative transcriptional regulator (RefSeq) 94, 116
BSU07970 yfjT hypothetical protein (RefSeq) 94, 157
BSU08520 recX recombination regulator RecX (RefSeq) 94, 258
BSU08530 yfhH hypothetical protein (RefSeq) 94, 270
BSU08650 fabL enoyl-(acyl carrier protein) reductase (RefSeq) 116, 253
BSU09610 yhdV integral membrane protein possibly involved in chromosome condensation (RefSeq) 94, 258
BSU10010 trpP tryptophan transporter (RefSeq) 64, 94
BSU11580 yjbK putative RNA/thiamine triphosphatase (RefSeq) 116, 167
BSU11590 yjbL putative phosphatase (RefSeq) 116, 194
BSU11600 yjbM (p)ppGpp synthetase (RefSeq) 116, 194
BSU12820 spoIISB two-component apoptotic control system component B (RefSeq) 94, 215
BSU12830 spoIISA two-component apoptosis factor (RefSeq) 94, 215
BSU13280 ykoJ hypothetical protein (RefSeq) 116, 146
BSU13820 ykvT cell wall hydrolase related to spore cortex-lytic enzymes (RefSeq) 116, 216
BSU13980 pbpH penicillin-binding enzyme for formation of rod-shaped peptidoglycan cell wall (RefSeq) 70, 94
BSU14840 ylaN hypothetical protein (RefSeq) 94, 310
BSU16000 ylqC putative RNA binding protein (RefSeq) 116, 212
BSU16800 spoIIIE spore DNA translocase (RefSeq) 23, 116
BSU16810 ymfC putative transcriptional regulator (GntR family) (RefSeq) 23, 116
BSU17050 mutL DNA mismatch repair protein (RefSeq) 116, 228
BSU18110 ynfC hypothetical protein (RefSeq) 44, 94
BSU18390 yoeC putative bacteriophage integrase (RefSeq) 94, 157
BSU18990 yobK hypothetical protein (RefSeq) 113, 116
BSU19000 yobL putative phage DNA manipulating enzyme (RefSeq) 113, 116
BSU19300 yozC hypothetical protein (RefSeq) 94, 215
BSU19340 yocR putative sodium-dependent transporter (RefSeq) 116, 191
BSU21720 ypmT hypothetical protein (RefSeq) 116, 170
BSU21910 metA homoserine O-succinyltransferase (RefSeq) 94, 327
BSU22910 ypfA putative cyclic diGMP binding protein (RefSeq) 7, 116
BSU22980 ypbG putative phosphoesterase (RefSeq) 94, 258
BSU23040 fer ferredoxin (RefSeq) 94, 151
BSU23230 ypuF hypothetical protein (RefSeq) 94, 226
BSU23240 ypzK putative acetyltransferase (RefSeq) 94, 208
BSU23310 sipS type I signal peptidase (RefSeq) 94, 159
BSU23760 coaA pantothenate kinase (RefSeq) 116, 233
BSU23830 yqjL putative hydrolase (RefSeq) 94, 217
BSU25110 yqfU putative integral inner membrane protein (RefSeq) 116, 123
BSU26790 aadK aminoglycoside 6-adenylyltransferase (RefSeq) 94, 404
BSU26800 yrpB putative anionic nitroalkane dioxygenase (RefSeq) 35, 94
BSU29000 nrdR transcriptional regulator NrdR (RefSeq) 94, 270
BSU31150 yubB undecaprenyl pyrophosphate phosphatase (RefSeq) 116, 155
BSU32330 lipA lipoyl synthase (RefSeq) 116, 128
BSU32620 yurQ putative excinuclease (RefSeq) 116, 309
BSU35260 ftsE cell-division ABC transporter (ATP-binding protein) (RefSeq) 13, 116
BSU38220 ywcC putative transcriptional regulator (RefSeq) 102, 116
BSU38360 ywbD putative AdoMet-dependent methyltransferase (RefSeq) 116, 157
BSU38450 ywaE putative transcriptional regulator (MarR family) (RefSeq) 94, 341
BSU38480 ywaC (p)ppGpp synthetase (RefSeq) 71, 94
BSU39550 yxeH putative hydrolase (RefSeq) 116, 233
BSU40650 yybG hypothetical protein (RefSeq) 36, 116
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU05390
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend