Organism : Bacillus subtilis | Module List:
Module 15 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 15

There are 8 regulatory influences for Module 15

Regulator Table (8)
Regulator Name Type
BSU19050 tf
BSU01080 tf
BSU04650 tf
BSU16600 tf
BSU01430 tf
BSU01070 tf
BSU00470 tf
BSU01010 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
4992 1.90e+00 ccATcCtCCtGtTgtTTaCac
Loader icon
4993 6.20e+01 CGGTCTTCCTCCATCCGTTCTCC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 15 is enriched for following functions.

KEGG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini Hochberg pvalue Genes with function Method
Metabolism kegg category 4.90e-05 5.66e-04 11/21
Amino Acid Metabolism kegg subcategory 2.03e-02 3.97e-02 3/21
Metabolism of Cofactors and Vitamins kegg subcategory 2.28e-04 1.80e-03 4/21
Nicotinate and nicotinamide metabolism kegg pathway 0.00e+00 3.00e-06 3/21
Metabolism of Terpenoids and Polyketides kegg subcategory 9.10e-05 8.96e-04 3/21
Terpenoid backbone biosynthesis kegg pathway 1.00e-06 1.40e-05 3/21
Genetic Information Processing kegg category 2.99e-03 1.04e-02 4/21
Environmental Information Processing kegg category 1.08e-02 2.46e-02 4/21
Membrane Transport kegg subcategory 9.60e-03 2.25e-02 3/21
ABC transporters kegg pathway 3.71e-03 1.19e-02 3/21
Global kegg category 6.00e-05 6.63e-04 10/21
Metabolism kegg subcategory 6.00e-05 6.63e-04 10/21
Metabolic pathways kegg pathway 1.13e-03 5.75e-03 8/21

TIGRFam Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Transcription tigr mainrole 3.00e-06 9.00e-06 3/21
Biosynthesis of cofactors, prosthetic groups, and carriers tigr mainrole 6.80e-05 1.43e-04 4/21
Pyridine nucleotides tigr sub1role 0.00e+00 0.00e+00 3/21

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Metabolism cog category 2.70e-03 4.64e-03 12/21
Amino acid transport and metabolism cog subcategory 3.53e-03 5.97e-03 5/21
Coenzyme transport and metabolism cog subcategory 2.80e-05 8.70e-05 5/21
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 15

There are 21 genes in Module 15

Gene Member Table (21)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
BSU01070 rpoB CDS None chromosome 121916 125497 + DNA-directed RNA polymerase subunit beta (RefSeq) True
BSU01080 rpoC CDS None chromosome 125559 129158 + DNA-directed RNA polymerase subunit beta' (RefSeq) True
BSU02980 opuAA CDS None chromosome 320565 321821 + glycine betaine ABC transporter (ATP-binding protein) (RefSeq) False
BSU02990 opuAB CDS None chromosome 321823 322671 + glycine betaine ABC transporter (permease) (RefSeq) False
BSU03000 opuAC CDS None chromosome 322671 323552 + glycine betaine ABC transporter (glycine betaine-binding lipoprotein) (RefSeq) False
BSU06690 gatB CDS None chromosome 729848 731278 + aspartyl/glutamyl-tRNA amidotransferase subunit B (RefSeq) False
BSU10350 yhfS CDS None chromosome 1108692 1109786 - acetyl-CoA acetyltransferase (RefSeq) False
BSU10360 yhfT CDS None chromosome 1109783 1111222 - acyl-CoA synthetase (RefSeq) False
BSU10370 bioY CDS None chromosome 1111229 1111789 - biotin transporter (RefSeq) False
BSU22740 hepT CDS None chromosome 2381117 2382163 - heptaprenyl diphosphate synthase component II (RefSeq) False
BSU22760 hepS CDS None chromosome 2382813 2383568 - heptaprenyl diphosphate synthase component I (RefSeq) False
BSU23070 serA CDS None chromosome 2410280 2411857 + D-3-phosphoglycerate dehydrogenase (RefSeq) False
BSU27850 nadA CDS None chromosome 2845180 2846286 - quinolinate synthetase (RefSeq) False
BSU27860 nadC CDS None chromosome 2846273 2847142 - nicotinate-nucleotide pyrophosphorylase (RefSeq) False
BSU27870 nadB CDS None chromosome 2847096 2848691 - L-aspartate oxidase (RefSeq) False
BSU27880 nifS CDS None chromosome 2848794 2849981 + cysteine desulfurase (RefSeq) False
BSU27890 nadR CDS None chromosome 2849941 2850477 + transcriptional repressor of de novo NAD biosynthesis (RefSeq) False
BSU38500 dltA CDS None chromosome 3951296 3952807 + D-alanine--poly(phosphoribitol) ligase subunit 1 (RefSeq) False
BSU38510 dltB CDS None chromosome 3952804 3953991 + putative D-alanine esterase for lipoteichoic acid and wall teichoic acid (RefSeq) False
BSU38530 dltD CDS None chromosome 3954244 3955422 + putative D-alanine esterase for lipoteichoic acid and wall teichoic acid synthesis (RefSeq) False
BSU41050 rnpA CDS None chromosome 4213777 4214127 - ribonuclease P (RefSeq) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 15

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.