Organism : Bacteroides thetaiotaomicron VPI-5482 | Module List :
NP_810002.1 BT_1089

None

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for NP_810002.1
(Mouseover regulator name to see its description)

Warning: No Regulators were found for NP_810002.1!

Warning: NP_810002.1 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5860 3.10e-06 TatcTTTGt.
Loader icon
5861 1.10e+04 GCATTAGTAATGTAATGCATTGAC
Loader icon
6452 1.70e+00 ttcgTaaaTTTgc
Loader icon
6453 4.70e+02 Gta.tTTtGCcaCaggA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for NP_810002.1

Warning: No Functional annotations were found!

Module neighborhood information for NP_810002.1

NP_810002.1 has total of 40 gene neighbors in modules 68, 370
Gene neighbors (40)
Gene Common Name Description Module membership
NP_809069.1 BT_0156 None 191, 370
NP_809097.1 BT_0184 None 68, 96
NP_809098.1 BT_0185 None 68, 78
NP_809162.1 BT_0249 None 191, 370
NP_809170.1 BT_0257 None 370, 382
NP_809322.1 BT_0409 None 370, 418
NP_809323.1 BT_0410 None 170, 370
NP_809537.1 BT_0624 None 68, 156
NP_809548.1 BT_0635 None 14, 68
NP_809549.1 BT_0636 None 68, 168
NP_809573.1 BT_0660 None 68, 117
NP_809725.1 BT_0812 None 68, 114
NP_809726.1 BT_0813 None 68, 114
NP_809827.1 BT_0914 None 68, 244
NP_809835.1 BT_0922 None 68, 168
NP_809836.1 BT_0923 None 68, 273
NP_809840.1 BT_0927 None 68, 156
NP_809841.1 BT_0928 None 14, 68
NP_810002.1 BT_1089 None 68, 370
NP_810024.1 BT_1111 None 68, 450
NP_810098.1 BT_1185 None 68, 458
NP_810114.1 BT_1201 None 191, 370
NP_810115.1 BT_1202 None 90, 370
NP_810116.1 BT_1203 None 90, 370
NP_810147.1 BT_1234 None 68, 378
NP_810277.1 BT_1364 None 370, 418
NP_810326.1 BT_1413 None 14, 68
NP_810588.1 BT_1675 None 370, 397
NP_810892.1 BT_1979 None 242, 370
NP_811282.1 BT_2369 None 68, 189
NP_811563.1 BT_2650 None 68, 189
NP_812175.1 BT_3263 None 24, 370
NP_812554.1 BT_3643 None 68, 113
NP_812628.1 BT_3717 None 187, 370
NP_812635.1 BT_3724 None 170, 370
NP_812810.1 BT_3899 None 68, 188
NP_813028.1 BT_4117 None 68, 152
NP_813284.1 BT_4373 None 68, 370
NP_813511.1 BT_4600 None 338, 370
NP_813652.1 BT_4741 None 68, 177
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for NP_810002.1
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend