Organism : Campylobacter jejuni | Module List :
Cj1230 hspR

putative heat shock transcriptional regulator (NCBI ptt file)

CircVis
Functional Annotations (5)
Function System
Predicted transcriptional regulators cog/ cog
nucleotide binding go/ molecular_function
sequence-specific DNA binding transcription factor activity go/ molecular_function
nucleus go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Cj1230
(Mouseover regulator name to see its description)

Cj1230 is regulated by 3 influences and regulates 13 modules.
Regulators for Cj1230 hspR (3)
Regulator Module Operator
Cj0400 83 tf
Cj0757 64 tf
Cj1230 64 tf

Warning: Cj1230 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7510 1.80e+01 TAAAAccTTaAgtgAaAAAAA
Loader icon
7511 2.90e+02 CTTGATTGACTTAGGCTAAAG
Loader icon
7548 1.80e+00 TtagCTtagGCaAAg
Loader icon
7549 3.70e+02 cACT.AAGgtTttAttTaca
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Cj1230

Cj1230 is enriched for 5 functions in 3 categories.
Enrichment Table (5)
Function System
Predicted transcriptional regulators cog/ cog
nucleotide binding go/ molecular_function
sequence-specific DNA binding transcription factor activity go/ molecular_function
nucleus go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for Cj1230

Cj1230 has total of 42 gene neighbors in modules 64, 83
Gene neighbors (42)
Gene Common Name Description Module membership
Cj0046 Cj0046 None 35, 64
Cj0095 rpmA 50S ribosomal protein L27 (NCBI ptt file) 14, 83
Cj0137 Cj0137 hypothetical protein Cj0137 (NCBI ptt file) 83, 125
Cj0186c Cj0186c putative integral membrane protein (NCBI ptt file) 83, 112
Cj0196c purF amidophosphoribosyltransferase (NCBI ptt file) 83, 145
Cj0232c Cj0232c putative integral membrane protein (NCBI ptt file) 83, 150
Cj0234c frr ribosome recycling factor (NCBI ptt file) 83, 103
Cj0269c ilvE branched-chain amino acid aminotransferase (NCBI ptt file) 83, 111
Cj0292c Cj0292c None 5, 64
Cj0366c Cj0366c transmembrane efflux protein (NCBI ptt file) 83, 158
Cj0399 Cj0399 putative integral membrane protein (NCBI ptt file) 82, 83
Cj0400 fur ferric uptake regulator (NCBI ptt file) 83, 170
Cj0442 fabF 3-oxoacyl-[acyl-carrier-protein] synthase (NCBI ptt file) 83, 98
Cj0491 rpsL 30S ribosomal protein S12 (NCBI ptt file) 30, 83
Cj0596 peb4cbf2 major antigenic peptide PEB3cell binding factor 2 (VIMSS-AUTO) 83, 157
Cj0597 fba fructose-bisphosphate aldolase (NCBI ptt file) 83, 157
Cj0702 purE phosphoribosylaminoimidazole carboxylase catalytic subunit (NCBI ptt file) 83, 141
Cj1027c gyrA DNA gyrase subunit A (NCBI ptt file) 9, 83
Cj1045c thiG thiG protein (NCBI ptt file) 42, 64
Cj1070 rpsF 30S ribosomal protein S6 (NCBI ptt file) 83, 102
Cj1175c argS arginyl-tRNA synthetase (NCBI ptt file) 83, 157
Cj1177c gmk guanylate kinase (NCBI ptt file) 43, 83
Cj1197c gatB Glu-tRNAGln amidotransferase subunit B (NCBI ptt file) 64, 110
Cj1202 metF 5,10-methylenetetrahydrofolate reductase (NCBI ptt file) 6, 64
Cj1226c Cj1226c putative two-component sensor (NCBI ptt file) 17, 64
Cj1227c Cj1227c putative two-component regulator (NCBI ptt file) 64, 83
Cj1228c htrA serine protease (protease DO) (NCBI ptt file) 61, 64
Cj1229 cbpA putative curved-DNA binding protein (NCBI ptt file) 17, 64
Cj1230 hspR putative heat shock transcriptional regulator (NCBI ptt file) 64, 83
Cj1231 kefB putative glutathione-regulated potassium-efflux system protein (NCBI ptt file) 17, 64
Cj1232 Cj1232 hypothetical protein Cj1232 (NCBI ptt file) 29, 64
Cj1233 Cj1233 putative hydrolase (NCBI ptt file) 17, 64
Cj1270c Cj1270c hypothetical protein Cj1270c (NCBI ptt file) 41, 83
Cj1287c Cj1287c malate oxidoreductase (NCBI ptt file) 52, 83
Cj1528 Cj1528 None 5, 64
Cj1535c pgi putative glucose-6-phosphate isomerase (NCBI ptt file) 24, 83
Cj1545c Cj1545c MdaB protein homolog (NCBI ptt file) 67, 83
Cj1597 hisG ATP phosphoribosyltransferase (NCBI ptt file) 83, 111
Cj1598 hisD histidinol dehydrogenase (NCBI ptt file) 83, 111
Cj1727c metY putative O-acetylhomoserine (thiol)-lyase (NCBI ptt file) 63, 83
Cjp24 tRNA-Phe tRNA-Phe (NCBI) 5, 64
Cjp26 tRNA-SeC tRNA-OTHER (NCBI) 64, 124
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Cj1230
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend