Organism : Pseudomonas aeruginosa | Module List :
PA0828

probable transcriptional regulator (NCBI)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulator cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
regulation of transcription, DNA-dependent go/ biological_process
specific transcriptional repressor activity go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for PA0828
(Mouseover regulator name to see its description)

PA0828 is regulated by 38 influences and regulates 35 modules.
Regulators for PA0828 (38)
Regulator Module Operator
PA0034 289 tf
PA0218 289 tf
PA0707 289 tf
PA0765 289 tf
PA0828 289 tf
PA0873 289 tf
PA1351 289 tf
PA1374 289 tf
PA1826 289 tf
PA1850 289 tf
PA2032 289 tf
PA2118 289 tf
PA2488 289 tf
PA2489 289 tf
PA2510 289 tf
PA2696 289 tf
PA2838 289 tf
PA3594 289 tf
PA3714 289 tf
PA3778 289 tf
PA5562 289 tf
PA0828 283 tf
PA0839 283 tf
PA0893 283 tf
PA1184 283 tf
PA1599 283 tf
PA1998 283 tf
PA2050 283 tf
PA2115 283 tf
PA2547 283 tf
PA2838 283 tf
PA2848 283 tf
PA3711 283 tf
PA3898 283 tf
PA4269 283 tf
PA4547 283 tf
PA4989 283 tf
PA5428 283 tf

Warning: PA0828 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
3394 1.50e+01 GatTcATcgcatTccgccAa.Cgt
Loader icon
3395 1.70e+03 AATGTTTGAGCGCGTAAGTGCGT
Loader icon
3406 6.00e-02 AaaagcAacacAtctaataAt
Loader icon
3407 4.40e+03 ttTTTCCtct
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for PA0828

PA0828 is enriched for 5 functions in 3 categories.
Module neighborhood information for PA0828

PA0828 has total of 45 gene neighbors in modules 283, 289
Gene neighbors (45)
Gene Common Name Description Module membership
PA0033 PA0033 hypothetical protein (NCBI) 289, 343
PA0192 PA0192 probable TonB-dependent receptor (NCBI) 235, 289
PA0264 PA0264 hypothetical protein (NCBI) 283, 372
PA0417 chpE probable chemotaxis protein (NCBI) 283, 346
PA0703 PA0703 probable major facilitator superfamily (MFS) transporter (NCBI) 283, 375
PA0756 PA0756 probable two-component response regulator (NCBI) 139, 283
PA0757 PA0757 probable two-component sensor (NCBI) 58, 283
PA0828 PA0828 probable transcriptional regulator (NCBI) 283, 289
PA1129 PA1129 probable fosfomycin resistance protein (NCBI) 30, 283
PA1402 PA1402 hypothetical protein (NCBI) 283, 546
PA1403 PA1403 probable transcriptional regulator (NCBI) 187, 283
PA1831 PA1831 hypothetical protein (NCBI) 283, 375
PA1878 PA1878 hypothetical protein (NCBI) 283, 295
PA1882 PA1882 probable transporter (NCBI) 283, 307
PA2074 PA2074 hypothetical protein (NCBI) 289, 516
PA2115 PA2115 probable transcriptional regulator (NCBI) 187, 283
PA2136 PA2136 hypothetical protein (NCBI) 280, 283
PA2200 PA2200 hypothetical protein (NCBI) 109, 289
PA2216 PA2216 hypothetical protein (NCBI) 289, 439
PA2241 pslK hypothetical protein (NCBI) 289, 522
PA2256 pvcC pyoverdine biosynthesis protein PvcC (NCBI) 199, 289
PA2282 PA2282 hypothetical protein (NCBI) 289, 461
PA2347 PA2347 hypothetical protein (NCBI) 289, 446
PA2349 PA2349 hypothetical protein (NCBI) 289, 307
PA2422 PA2422 hypothetical protein (NCBI) 34, 289
PA2428 PA2428 hypothetical protein (NCBI) 289, 302
PA2498 PA2498 hypothetical protein (NCBI) 289, 290
PA2547 PA2547 probable transcriptional regulator (NCBI) 283, 377
PA2691 PA2691 hypothetical protein (NCBI) 289, 475
PA2693 PA2693 hypothetical protein (NCBI) 283, 377
PA2844 PA2844 hypothetical protein (NCBI) 283, 313
PA2918 PA2918 probable short-chain dehydrogenase (NCBI) 289, 333
PA2923 hisJ periplasmic histidine-binding protein HisJ (NCBI) 211, 289
PA3406 hasD transport protein HasD (NCBI) 132, 289
PA3672 PA3672 probable ATP-binding component of ABC transporter (NCBI) 68, 283
PA4040 PA4040 hypothetical protein (NCBI) 97, 289
PA4181 PA4181 hypothetical protein (NCBI) 109, 289
PA4383 PA4383 hypothetical protein (NCBI) 245, 283
PA4522 ampD beta-lactamase expression regulator AmpD (NCBI) 283, 461
PA4885 irlR two-component response regulator (NCBI) 283, 418
PA4924 PA4924 hypothetical protein (NCBI) 68, 283
PA4995 PA4995 probable acyl-CoA dehydrogenase (NCBI) 283, 330
PA5081 PA5081 hypothetical protein (NCBI) 283, 507
PA5428 PA5428 probable transcriptional regulator (NCBI) 9, 283
PA5466 PA5466 hypothetical protein (NCBI) 70, 283
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for PA0828
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend