Organism : Rhodobacter sphaeroides 2.4.1 | Module List :
RSP_0547 nifA

NifA transcriptional activator (NCBI)

CircVis
Functional Annotations (11)
Function System
Transcriptional regulator containing GAF, AAA-type ATPase, and DNA binding domains cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
ATP binding go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
transcription factor binding go/ molecular_function
nitrogen fixation go/ biological_process
transcription activator activity go/ molecular_function
nucleoside-triphosphatase activity go/ molecular_function
Two-component system kegg/ kegg pathway
nifA tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for RSP_0547
(Mouseover regulator name to see its description)

RSP_0547 is regulated by 19 influences and regulates 34 modules.
Regulators for RSP_0547 nifA (19)
Regulator Module Operator
RSP_0547 27 tf
RSP_0768 27 tf
RSP_0794 27 tf
RSP_1486 27 tf
RSP_2171 27 tf
RSP_2346 27 tf
RSP_2533 27 tf
RSP_2889 27 tf
RSP_2963 27 tf
RSP_3238 27 tf
RSP_0443 139 tf
RSP_0527 139 tf
RSP_0623 139 tf
RSP_1518 139 tf
RSP_2346 139 tf
RSP_2572 139 tf
RSP_2888 139 tf
RSP_2963 139 tf
RSP_3238 139 tf

Warning: RSP_0547 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7774 5.90e+03 AgGAaAGA
Loader icon
7775 4.70e+03 TTTGcCaGTAA
Loader icon
7998 6.90e+00 AgCATGGgaTGtCAaTAtG
Loader icon
7999 1.90e+02 AAATGGACAGCGCTAACCAAAT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for RSP_0547

RSP_0547 is enriched for 11 functions in 3 categories.
Enrichment Table (11)
Function System
Transcriptional regulator containing GAF, AAA-type ATPase, and DNA binding domains cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
ATP binding go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
transcription factor binding go/ molecular_function
nitrogen fixation go/ biological_process
transcription activator activity go/ molecular_function
nucleoside-triphosphatase activity go/ molecular_function
Two-component system kegg/ kegg pathway
nifA tigr/ tigrfam
Module neighborhood information for RSP_0547

RSP_0547 has total of 33 gene neighbors in modules 27, 139
Gene neighbors (33)
Gene Common Name Description Module membership
RSP_0228 hmuS putative hemin transport protein (NCBI) 139, 163
RSP_0241 RSP_0241 Putative protein-S-isoprenylcysteine methyltransferase (NCBI) 139, 163
RSP_0275 bchO Magnesium-chelatase, BchO (NCBI) 139, 163
RSP_0428 RSP_0428 hypothetical protein (NCBI) 27, 163
RSP_0475 RSP_0475 cytochrome b (NCBI) 27, 264
RSP_0476 RSP_0476 L-fuculose-phosphate aldolase (NCBI) 27, 172
RSP_0527 rpoN sigma-54, RpoN (NCBI) 36, 139
RSP_0547 nifA NifA transcriptional activator (NCBI) 27, 139
RSP_0660 RSP_0660 hypothetical protein (NCBI) 49, 139
RSP_0679 hemC Porphobilinogen deaminase (NCBI) 139, 163
RSP_0680 hemE Uroporphyrinogen decarboxylase (NCBI) 139, 163
RSP_0768 RSP_0768 transcriptional regulator, LuxR family (NCBI) 27, 377
RSP_0948 otsA probable OtsA trehalose-6-phosphate synthase (NCBI) 27, 368
RSP_1565 appA AppA, antirepressor of ppsR, sensor of blue light (NCBI) 139, 358
RSP_1601 RSP_1601 hypothetical protein (NCBI) 27, 172
RSP_2020 RSP_2020 DHC, diheme cytochrome c (NCBI) 27, 313
RSP_2087 RSP_2087 hypothetical protein (NCBI) 45, 139
RSP_2572 crpK crpK, Fnr-type transcriptional regulator (NCBI) 139, 163
RSP_2573 RSP_2573 hypothetical protein (NCBI) 139, 377
RSP_2574 RSP_2574 hypothetical protein (NCBI) 27, 120
RSP_2749 RSP_2749 putative P4-family integrase (NCBI) 27, 172
RSP_2768 RSP_2768 5-methyltetrahydrofolate S-homocysteine methyltransferase (NCBI) 27, 71
RSP_2830 RSP_2830 hypothetical protein (NCBI) 92, 139
RSP_2858 RSP_2858 IndA involved in pigment biosynthesis (NCBI) 36, 139
RSP_2963 RSP_2963 transcriptional regulator, Crp-Fnr family (NCBI) 85, 139
RSP_3159 RSP_3159 ABC transporter, 2 fused ATPase and 1 inner membrane subunits (NCBI) 27, 144
RSP_3263 RSP_3263 Putative copper binding protein (NCBI) 27, 185
RSP_3264 RSP_3264 probable c-type cytochrome (NCBI) 14, 27
RSP_3299 RSP_3299 TRAP-T family transporter, periplasmic binding component (NCBI) 27, 36
RSP_3566 RSP_3566 dimethylglycine dehydrogenase (NCBI) 27, 168
RSP_3573 gvpA Gas vesicle protein GVPa (NCBI) 14, 27
RSP_3638 RSP_3638 hypothetical protein (NCBI) 27, 139
RSP_3825 RSP_3825 hypothetical protein (NCBI) 49, 139
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for RSP_0547
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend