Organism : Bacillus cereus ATCC14579 | Module List :
BC1032

Transcriptional repressor (NCBI ptt file)

CircVis
Functional Annotations (4)
Function System
Predicted transcriptional regulators cog/ cog
transcription repressor activity go/ molecular_function
sequence-specific DNA binding go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BC1032
(Mouseover regulator name to see its description)

BC1032 is regulated by 21 influences and regulates 8 modules.
Regulators for BC1032 (21)
Regulator Module Operator
BC0566 80 tf
BC0742 80 tf
BC1059 80 tf
BC1329 80 tf
BC2469 80 tf
BC2517 80 tf
BC3588 80 tf
BC3904 80 tf
BC4336 80 tf
BC4930 80 tf
BC5251 80 tf
BC0742 456 tf
BC1329 456 tf
BC2410 456 tf
BC2469 456 tf
BC2517 456 tf
BC2760 456 tf
BC3587 456 tf
BC3588 456 tf
BC4336 456 tf
BC4930 456 tf

Warning: BC1032 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4080 6.30e-14 CCCGATTGGTgAgggCTgATaAtc
Loader icon
4081 2.70e-04 GATtaaAGttTcaCTttAc
Loader icon
4822 5.20e-18 cgcgcTTTtAcggGcAGctag.cc
Loader icon
4823 2.90e-17 ATAAAGTGAAACTTTAATCAG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BC1032

BC1032 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Predicted transcriptional regulators cog/ cog
transcription repressor activity go/ molecular_function
sequence-specific DNA binding go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for BC1032

BC1032 has total of 31 gene neighbors in modules 80, 456
Gene neighbors (31)
Gene Common Name Description Module membership
BC0841 BC0841 Glucokinase regulatory protein (NCBI ptt file) 80, 387
BC0843 BC0843 outer surface protein (NCBI ptt file) 80, 387
BC0853 BC0853 Quaternary ammonium compound-resistance protein (NCBI ptt file) 80, 498
BC0960 BC0960 hypothetical protein (NCBI ptt file) 46, 80
BC1032 BC1032 Transcriptional repressor (NCBI ptt file) 80, 456
BC1106 BC1106 hypothetical protein (NCBI ptt file) 80, 377
BC1334 BC1334 hypothetical Exported Protein (NCBI ptt file) 80, 498
BC1440 BC1440 hypothetical protein (NCBI ptt file) 80, 387
BC1845 BC1845 hypothetical protein (NCBI ptt file) 80, 523
BC1950 BC1950 Microcin C7 self-immunity protein mccF (NCBI ptt file) 125, 456
BC2129 BC2129 hypothetical protein (NCBI ptt file) 80, 267
BC2297 BC2297 hypothetical protein (NCBI ptt file) 80, 291
BC2441 BC2441 hypothetical protein (NCBI ptt file) 436, 456
BC2503 BC2503 S-Adenosylhomocysteine nucleosidase (NCBI ptt file) 113, 456
BC3081 BC3081 hypothetical protein (NCBI ptt file) 235, 456
BC3082 BC3082 Ribosomal-protein-alanine acetyltransferase (NCBI ptt file) 327, 456
BC3199 BC3199 hypothetical Cytosolic Protein (NCBI ptt file) 317, 456
BC3206 BC3206 hypothetical protein (NCBI ptt file) 80, 130
BC3574 BC3574 Spore germination protein SA (NCBI ptt file) 80, 130
BC3575 BC3575 Spore germination protein SB (NCBI ptt file) 80, 130
BC3576 BC3576 Spore germination protein SC (NCBI ptt file) 80, 130
BC4265 BC4265 Phosphate transport system protein phoU (NCBI ptt file) 65, 456
BC4349 BC4349 hypothetical protein (NCBI ptt file) 46, 456
BC4497 BC4497 Tetracycline resistence protein TETA(L)/TETK (NCBI ptt file) 80, 456
BC4618 BC4618 hypothetical protein (NCBI ptt file) 158, 456
BC4786 BC4786 hypothetical Cytosolic Protein (NCBI ptt file) 456, 498
BC4896 BC4896 None 149, 456
BC4934 BC4934 hypothetical protein (NCBI ptt file) 80, 235
BC5346 BC5346 Cardiolipin synthetase (NCBI ptt file) 141, 456
BC5347 BC5347 UV-endonuclease (UvsE/Uve1/UvdE Family) (NCBI ptt file) 351, 456
BC5390 BC5390 Cell wall hydrolase cwlJ (NCBI ptt file) 351, 456
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BC1032
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend