Organism : Bacillus cereus ATCC14579 | Module List :
BC1987

Transcriptional regulator, GntR family (NCBI ptt file)

CircVis
Functional Annotations (7)
Function System
Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
biosynthetic process go/ biological_process
transferase activity, transferring nitrogenous groups go/ molecular_function
pyridoxal phosphate binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BC1987
(Mouseover regulator name to see its description)

BC1987 is regulated by 24 influences and regulates 14 modules.
Regulators for BC1987 (24)
Regulator Module Operator
BC0473 465 tf
BC0498 465 tf
BC0607 465 tf
BC0649 465 tf
BC1037 465 tf
BC1363 465 tf
BC1889 465 tf
BC1987 465 tf
BC2122 465 tf
BC2401 465 tf
BC3084 465 tf
BC3438 465 tf
BC4525 465 tf
BC1363 249 tf
BC1987 249 tf
BC2401 249 tf
BC2770 249 tf
BC3084 249 tf
BC3982 249 tf
BC4010 249 tf
BC4057 249 tf
BC4525 249 tf
BC5173 249 tf
BC5339 249 tf
Regulated by BC1987 (14)
Module Residual Genes
6 0.43 29
55 0.48 25
184 0.42 22
219 0.26 9
222 0.46 20
224 0.47 22
242 0.40 15
249 0.43 16
257 0.58 25
260 0.41 19
263 0.62 36
398 0.39 19
465 0.52 19
497 0.38 21
Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4414 1.80e-01 CcctTCtTgTtTaC
Loader icon
4415 1.10e+02 GGTTGGGGAGGTTACCAACC
Loader icon
4840 1.20e+03 GGGAGGTTACCAACC
Loader icon
4841 1.40e+01 ATtTCaCCTT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BC1987

BC1987 is enriched for 7 functions in 3 categories.
Module neighborhood information for BC1987

BC1987 has total of 30 gene neighbors in modules 249, 465
Gene neighbors (30)
Gene Common Name Description Module membership
BC0372 BC0372 hypothetical protein (NCBI ptt file) 249, 453
BC0603 BC0603 hypothetical Membrane Spanning Protein (NCBI ptt file) 225, 465
BC0674 BC0674 Permease (NCBI ptt file) 257, 465
BC0801 BC0801 Transcriptional regulator, LytR family (NCBI ptt file) 442, 465
BC0903 BC0903 Methyltransferase (NCBI ptt file) 55, 249
BC0927 BC0927 hypothetical protein (NCBI ptt file) 55, 249
BC1222 BC1222 Spore coat protein Y (NCBI ptt file) 246, 465
BC1242 BC1242 Integral membrane protein (NCBI ptt file) 442, 465
BC1986 BC1986 Transporter, LysE family (NCBI ptt file) 249, 465
BC1987 BC1987 Transcriptional regulator, GntR family (NCBI ptt file) 249, 465
BC1988 BC1988 hypothetical protein (NCBI ptt file) 249, 465
BC1990 BC1990 hypothetical Cytosolic Protein (NCBI ptt file) 6, 249
BC2270 BC2270 hypothetical protein (NCBI ptt file) 249, 465
BC2619 BC2619 Sporulation kinase (NCBI ptt file) 465, 481
BC2673 BC2673 Tetracycline resistance determinant tetV (NCBI ptt file) 263, 465
BC2818 BC2818 hypothetical Cytosolic Protein (NCBI ptt file) 148, 249
BC2863 BC2863 Two component system histidine kinase (NCBI ptt file) 265, 465
BC2887 BC2887 hypothetical Cytosolic Protein (NCBI ptt file) 399, 465
BC2977 BC2977 Pyrroline-5-carboxylate reductase (NCBI ptt file) 148, 249
BC3084 BC3084 Transcriptional regulator, TetR family (NCBI ptt file) 249, 399
BC3118 BC3118 Cytochrome p450 (NCBI ptt file) 449, 465
BC3209 BC3209 hypothetical Cytosolic Protein (NCBI ptt file) 343, 465
BC3456 BC3456 Bicyclomycin resistance protein (NCBI ptt file) 249, 465
BC3498 BC3498 Quinone oxidoreductase (NCBI ptt file) 63, 465
BC4021 BC4021 hypothetical protein (NCBI ptt file) 55, 249
BC4022 BC4022 ABC transporter ATP-binding protein (NCBI ptt file) 55, 249
BC4851 BC4851 O-succinylbenzoic acid--CoA ligase (NCBI ptt file) 465, 467
BC5064 BC5064 hypothetical protein (NCBI ptt file) 37, 249
BC5239 BC5239 enterotoxin / cell-wall binding protein (NCBI ptt file) 399, 465
BC5337 BC5337 hypothetical protein (NCBI ptt file) 148, 249
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BC1987
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend