Organism : Bacillus cereus ATCC14579 | Module List :
BC3669

Murein hydrolase exporter (NCBI ptt file)

CircVis
Functional Annotations (2)
Function System
Putative effector of murein hydrolase LrgA cog/ cog
integral to membrane go/ cellular_component
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BC3669
(Mouseover regulator name to see its description)

BC3669 is regulated by 30 influences and regulates 0 modules.
Regulators for BC3669 (30)
Regulator Module Operator
BC0123 298 tf
BC0265 298 tf
BC0435 298 tf
BC0473 298 tf
BC1715 298 tf
BC1731 298 tf
BC2470 298 tf
BC2903 298 tf
BC2936 298 tf
BC3313 298 tf
BC3668 298 tf
BC3961 298 tf
BC4101 298 tf
BC4240 298 tf
BC5205 298 tf
BC5250 298 tf
BC5402 298 tf
BC5409 298 tf
BC0122 403 tf
BC0123 403 tf
BC0586 403 tf
BC1302 403 tf
BC1818 403 tf
BC3476 403 tf
BC3976 403 tf
BC4057 403 tf
BC4589 403 tf
BC4603 403 tf
BC5339 403 tf
BC5368 403 tf

Warning: BC3669 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4510 2.80e+02 AaAaaaacAGGTaG
Loader icon
4511 3.70e+03 AttAGACAAacATt
Loader icon
4716 1.10e+01 CacCTCa
Loader icon
4717 1.10e+02 CGAAAGGCCTGTCAACGTTTAGC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BC3669

BC3669 is enriched for 2 functions in 3 categories.
Enrichment Table (2)
Function System
Putative effector of murein hydrolase LrgA cog/ cog
integral to membrane go/ cellular_component
Module neighborhood information for BC3669

BC3669 has total of 21 gene neighbors in modules 298, 403
Gene neighbors (21)
Gene Common Name Description Module membership
BC0015 BC0015 pyridoxine biosynthesis protein (NCBI ptt file) 51, 298
BC0016 BC0016 pyridoxine biosynthesis amidotransferase (NCBI ptt file) 51, 298
BC0038 BC0038 Tpl protein (NCBI ptt file) 81, 403
BC0039 BC0039 hypothetical protein (NCBI ptt file) 64, 403
BC0667 BC0667 Bicyclomycin resistance protein (NCBI ptt file) 152, 403
BC1200 BC1200 Ribosomal large subunit pseudouridine synthase D (NCBI ptt file) 403, 474
BC3313 BC3313 Transcriptional regulator, MarR family (NCBI ptt file) 88, 298
BC3314 BC3314 Quinolone resistence NorA protein (NCBI ptt file) 298, 414
BC3669 BC3669 Murein hydrolase exporter (NCBI ptt file) 298, 403
BC3670 BC3670 Murein hydrolase export regulator (NCBI ptt file) 298, 403
BC3906 BC3906 Cell division protein ftsZ (NCBI ptt file) 298, 300
BC4201 BC4201 hypothetical Membrane Spanning Protein (NCBI ptt file) 103, 298
BC4202 BC4202 hypothetical Membrane Spanning Protein (NCBI ptt file) 103, 298
BC4603 BC4603 Transcriptional regulator, GntR family (NCBI ptt file) 403, 474
BC4604 BC4604 NAD-dependent malic enzyme (NCBI ptt file) 201, 403
BC4855 BC4855 2-oxoglutarate decarboxylase (NCBI ptt file) 403, 467
BC4856 BC4856 Isochorismate synthase (NCBI ptt file) 403, 467
BC4857 BC4857 1,4-dihydroxy-2-naphthoate octaprenyltransferase (NCBI ptt file) 403, 455
BC5183 BC5183 hypothetical Membrane Spanning Protein (NCBI ptt file) 296, 298
BC5326 BC5326 hypothetical protein (NCBI ptt file) 403, 433
BC5368 BC5368 Transcriptional regulator pfoR (NCBI ptt file) 219, 403
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BC3669
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend