Organism : Bacillus subtilis | Module List :
BSU05050 lrpA

transcriptional regulator (Lrp/AsnC family) (RefSeq)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
sequence-specific DNA binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU05050
(Mouseover regulator name to see its description)

BSU05050 is regulated by 15 influences and regulates 15 modules.
Regulators for BSU05050 lrpA (15)
Regulator Module Operator
BSU04650 197 tf
BSU05050 197 tf
BSU09510 197 tf
BSU16170 197 tf
BSU23450 197 tf
BSU24520 197 tf
BSU26720 197 tf
BSU37160 197 tf
BSU05050 255 tf
BSU05320 255 tf
BSU05420 255 tf
BSU16900 255 tf
BSU18850 255 tf
BSU35520 255 tf
BSU36630 255 tf

Warning: BSU05050 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5338 9.80e+00 AG.tGgtgAAA
Loader icon
5339 1.20e+03 CAAGGTCATAGAGCCGTTTTCGAC
Loader icon
5450 3.30e-01 aAAGgagGtgA
Loader icon
5451 3.70e-01 TCaTTtCCccgcCcccaTcAA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU05050

BSU05050 is enriched for 5 functions in 3 categories.
Enrichment Table (5)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
sequence-specific DNA binding go/ molecular_function
Module neighborhood information for BSU05050

BSU05050 has total of 54 gene neighbors in modules 197, 255
Gene neighbors (54)
Gene Common Name Description Module membership
BSU00150 dgk deoxyguanosine kinase (RefSeq) 197, 385
BSU02120 ybeC putative H+/amino acid transporter (RefSeq) 219, 255
BSU04620 acpS 4'-phosphopantetheinyl transferase (RefSeq) 245, 255
BSU05050 lrpA transcriptional regulator (Lrp/AsnC family) (RefSeq) 197, 255
BSU05070 yddQ putative hydrolase (RefSeq) 23, 255
BSU05080 yddR putative metal-dependent hydrolase (RefSeq) 38, 255
BSU05320 ydeS putative transcriptional regulator (TetR/AcrR family) (RefSeq) 233, 255
BSU05420 ydfI two-component response regulator [YdfH] (RefSeq) 199, 255
BSU05470 ydfM putative divalent cation efflux transporter (RefSeq) 132, 197
BSU08050 yfjL hypothetical protein (RefSeq) 102, 255
BSU08710 gsaB glutamate-1-semialdehyde aminotransferase (RefSeq) 255, 322
BSU08930 cspR putative rRNA methylase (RefSeq) 197, 319
BSU11720 fabI enoyl-(acyl carrier protein) reductase (RefSeq) 255, 309
BSU14100 ykuJ hypothetical protein (RefSeq) 197, 385
BSU14520 adeC adenine deaminase (RefSeq) 42, 255
BSU14550 ykrA putative hydrolase (RefSeq) 23, 255
BSU15800 thiN thiamine pyrophosphokinase (RefSeq) 197, 385
BSU15820 rpmB 50S ribosomal protein L28 (RefSeq) 119, 197
BSU16680 rpsO 30S ribosomal protein S15 (RefSeq) 119, 197
BSU17660 yncF putative deoxyuridine 5'-triphosphate pyrophosphatase (RefSeq) 135, 255
BSU17680 thyA thymidylate synthase (RefSeq) 128, 255
BSU19460 yojG putative deacetylase (RefSeq) 197, 354
BSU19480 yojE putative integral inner membrane protein (RefSeq) 102, 255
BSU21860 yphP hypothetical protein (RefSeq) 197, 309
BSU22790 hbs non-specific DNA-binding protein HBsu; signal recognition particle-like (SRP) component (RefSeq) 128, 197
BSU24530 yqhM putative lipoate protein ligase (RefSeq) 119, 197
BSU24540 yqhL putative sulfur transferase (RefSeq) 119, 197
BSU24930 yqzD hypothetical protein (RefSeq) 23, 197
BSU24940 yqzC hypothetical protein (RefSeq) 23, 197
BSU25550 rpsT 30S ribosomal protein S20 (RefSeq) 128, 197
BSU26050 yqdB hypothetical protein; skin element (NCBI) 163, 255
BSU27100 yrhP putative efflux transporter (RefSeq) 199, 255
BSU27370 yrrL hypothetical protein (RefSeq) 13, 255
BSU29660 rpsD 30S ribosomal protein S4 (RefSeq) 119, 197
BSU29930 amyX pullulanase (RefSeq) 255, 313
BSU29940 ytlR putative phospholipid kinase (RefSeq) 255, 313
BSU31110 yubF hypothetical protein (RefSeq) 23, 197
BSU31120 lytG exoglucosaminidase (RefSeq) 197, 402
BSU31740 yuxH putative phosphodiesterase (RefSeq) 247, 255
BSU32050 yuiE leucyl aminopeptidase (RefSeq) 80, 255
BSU32290 yutF putative p-nitrophenyl phosphatase (RefSeq) 213, 255
BSU32300 yutE hypothetical protein (RefSeq) 247, 255
BSU32310 yutD hypothetical protein (RefSeq) 247, 255
BSU32320 yutC putative lipoprotein (RefSeq) 239, 255
BSU33360 yvgJ putative exported enzyme and transporter (RefSeq) 219, 255
BSU33870 yvbI putative permease (RefSeq) 197, 266
BSU33970 araR transcriptional repressor of the ara regulon (LacI family) (RefSeq) 23, 255
BSU36260 ywqC modulator of YwqD protein tyrosine kinase activity (RefSeq) 187, 197
BSU36560 ywnH putative phosphinothricin acetyltransferase (RefSeq) 23, 197
BSU36570 ywnG putative integral inner membrane protein (RefSeq) 23, 197
BSU36900 glyA serine hydroxymethyltransferase (RefSeq) 128, 197
BSU37160 rpoE DNA-directed RNA polymerase subunit delta (RefSeq) 197, 266
BSU38540 dltE putative oxidoreductase (RefSeq) 197, 273
BSU40830 yyaK putative integral inner membrane protein (RefSeq) 187, 255
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU05050
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend