Organism : Bacillus subtilis | Module List :
BSU06960 yesN

two-component response regulator [YesM] (RefSeq)

CircVis
Functional Annotations (9)
Function System
Response regulator containing CheY-like receiver domain and AraC-type DNA-binding domain cog/ cog
two-component response regulator activity go/ molecular_function
two-component signal transduction system (phosphorelay) go/ biological_process
DNA binding go/ molecular_function
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
sequence-specific DNA binding go/ molecular_function
Two-component system kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU06960
(Mouseover regulator name to see its description)

BSU06960 is regulated by 17 influences and regulates 26 modules.
Regulators for BSU06960 yesN (17)
Regulator Module Operator
BSU02070 156 tf
BSU06580 156 tf
BSU06960 156 tf
BSU07590 156 tf
BSU09830 156 tf
BSU16810 156 tf
BSU26320 156 tf
BSU27320 156 tf
BSU28410 156 tf
BSU33950 156 tf
BSU06960 250 tf
BSU07590 250 tf
BSU15320 250 tf
BSU29630 250 tf
BSU30150 250 tf
BSU30260 250 tf
BSU35910 250 tf

Warning: BSU06960 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5260 6.30e-08 CcgctttTcC.ttcaccTtTc
Loader icon
5261 7.60e+01 CAGCTGCCACCAAGCCAGATTCCC
Loader icon
5442 1.80e+00 AgCGctTacAAggAg
Loader icon
5443 1.70e+03 CCCCGCC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU06960

BSU06960 is enriched for 9 functions in 3 categories.
Module neighborhood information for BSU06960

BSU06960 has total of 45 gene neighbors in modules 156, 250
Gene neighbors (45)
Gene Common Name Description Module membership
BSU03110 ycgH putative amino acid transporter (RefSeq) 96, 156
BSU03120 ycgI putative methyltransferase (RefSeq) 156, 180
BSU03680 yclG putative uronase (RefSeq) 129, 156
BSU06920 yesJ putative acetyltransferase (RefSeq) 33, 156
BSU06930 yesK putative permease (RefSeq) 33, 156
BSU06950 yesM two-component sensor histidine kinase [YesN] (RefSeq) 250, 328
BSU06960 yesN two-component response regulator [YesM] (RefSeq) 156, 250
BSU07270 yfnH putative sugar-phosphate cytidylyltransferase (RefSeq) 156, 277
BSU07580 citS two-component sensor histidine kinase (RefSeq) 152, 156
BSU07590 citT two-component response regulator (RefSeq) 152, 156
BSU07600 yflP hypothetical protein (RefSeq) 152, 156
BSU08260 yfiG putative sugar transporter (RefSeq) 250, 328
BSU08270 yfiH putative sugar-phosphate epimerase/isomerase (RefSeq) 250, 328
BSU09880 yhaR enoyl-CoA hydratase (RefSeq) 133, 250
BSU13710 ykvI putative transporter (RefSeq) 156, 286
BSU15650 yloB P-type calcium transport ATPase (RefSeq) 156, 286
BSU18270 ynzE hypothetical protein (RefSeq) 156, 405
BSU28380 gerM germination (cortex hydrolysis) and sporulation (stage II, multiple polar septa) lytic enzyme (RefSeq) 156, 396
BSU28720 abfA alpha-L-arabinofuranosidase (RefSeq) 152, 250
BSU28730 araQ arabinose/arabinan permease (RefSeq) 61, 250
BSU28740 araP arabinose/arabinan permease (RefSeq) 250, 330
BSU28750 araN sugar-binding lipoprotein (RefSeq) 61, 250
BSU28760 araM putative metabolite-phosphate dehydrogenase (RefSeq) 250, 328
BSU28770 araL putative phosphatase (RefSeq) 152, 250
BSU28780 araD L-ribulose-5-phosphate 4-epimerase (RefSeq) 250, 328
BSU28790 araB ribulokinase (RefSeq) 152, 250
BSU28800 araA L-arabinose isomerase (RefSeq) 152, 250
BSU30160 ytcQ putative ABC transporter (binding lipoprotein) (RefSeq) 250, 328
BSU30170 ytcP putative ABC transporter (permease) (RefSeq) 250, 328
BSU30260 msmR transcriptional regulator (LacI family) (RefSeq) 22, 250
BSU30270 msmE multiple sugar-binding lipoprotein (RefSeq) 133, 250
BSU30280 amyD carbohydrate ABC transporter (permease) (RefSeq) 133, 250
BSU30290 amyC maltose and multiple sugars ABC transporter (permease) (RefSeq) 133, 250
BSU30300 melA alpha-D-galactoside galactohydrolase (RefSeq) 26, 250
BSU31220 yuxG short chain dehydrogenase (RefSeq) 156, 330
BSU34120 ganB secreted arabinogalactan oligomer endo-hydrolase (RefSeq) 152, 156
BSU34140 ganQ arabinogalactan oligomer permease (RefSeq) 152, 156
BSU34150 ganP arabinogalactan oligomer permease (RefSeq) 152, 156
BSU34160 cycB cyclodextrin-binding lipoprotein (RefSeq) 152, 156
BSU38240 ywcA putative acetate Na+-dependent symporter (RefSeq) 33, 250
BSU38990 scoA succinyl CoA:3-oxoacid CoA-transferase (subunit A) (RefSeq) 156, 180
BSU39000 yxjC putative permease (RefSeq) 55, 156
BSU39860 aldX putative aldehyde dehydrogenase (RefSeq) 156, 318
BSU40430 yycE hypothetical protein (RefSeq) 156, 231
BSU40940 yyaD putative integral membrane protein; putative transporter (RefSeq) 156, 406
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU06960
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend