Organism : Bacillus subtilis | Module List :
BSU26320 yqaG

putative transcriptional regulator; skin element (RefSeq)

CircVis
Functional Annotations (1)
Function System
sequence-specific DNA binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU26320
(Mouseover regulator name to see its description)

BSU26320 is regulated by 22 influences and regulates 29 modules.
Regulators for BSU26320 yqaG (22)
Regulator Module Operator
BSU02000 371 tf
BSU06140 371 tf
BSU06960 371 tf
BSU09480 371 tf
BSU09500 371 tf
BSU26220 371 tf
BSU26320 371 tf
BSU26340 371 tf
BSU30150 371 tf
BSU36600 371 tf
BSU37290 371 tf
BSU39850 371 tf
BSU00800 88 tf
BSU02220 88 tf
BSU09480 88 tf
BSU09500 88 tf
BSU13870 88 tf
BSU15690 88 tf
BSU26320 88 tf
BSU30150 88 tf
BSU37290 88 tf
BSU40800 88 tf

Warning: BSU26320 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5130 6.10e-03 tgaccaGcGgaTggatgaaaAga
Loader icon
5131 8.20e+00 CATAGAGGGCCTGCCACGGGGCAC
Loader icon
5658 4.70e+00 aAGgagGtGatca
Loader icon
5659 1.80e+04 gcCggacCaCCcGAcAaaAaG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU26320

BSU26320 is enriched for 1 functions in 2 categories.
Enrichment Table (1)
Function System
sequence-specific DNA binding go/ molecular_function
Module neighborhood information for BSU26320

BSU26320 has total of 34 gene neighbors in modules 88, 371
Gene neighbors (34)
Gene Common Name Description Module membership
BSU02660 ycbU putative cysteine desulfurase (RefSeq) 26, 371
BSU05360 ydfC putative permease (RefSeq) 88, 175
BSU06990 yesQ rhamnogalacturonan permease (RefSeq) 360, 371
BSU08280 yfiI putative oxidoreductase (RefSeq) 360, 371
BSU08330 yfiN putative ABC transporter (permease) (RefSeq) 175, 371
BSU09400 spoVR spore cortex synthesis protein (stage V sporulation) (RefSeq) 88, 126
BSU10580 yhjO hypothetical protein (RefSeq) 175, 371
BSU10590 yhjP hypothetical protein (RefSeq) 130, 371
BSU10610 yhjR putative electron carrier protein (RefSeq) 88, 108
BSU13050 ykzH hypothetical protein (RefSeq) 88, 175
BSU13060 ykjA hypothetical protein (RefSeq) 74, 88
BSU14330 yknV putative ABC transporter (ATP-binding protein) (RefSeq) 88, 205
BSU23420 spoVAC stage V sporulation protein AC (RefSeq) 88, 367
BSU23430 spoVAB stage V sporulation protein AB (RefSeq) 88, 367
BSU24410 spoIIIAC stage III sporulation protein (RefSeq) 88, 230
BSU25920 yqxG putative phage-related lytic exoenzyme; skin element (RefSeq) 206, 371
BSU26090 yqbJ conserved hypothetical protein; skin element (RefSeq) 88, 130
BSU26140 yqbE putative phage capsid protein; skin element (RefSeq) 206, 371
BSU26260 yqaM hypothetical protein (RefSeq) 371, 372
BSU26270 yqaL putative DNA-binding protein; skin element (RefSeq) 371, 372
BSU26280 yqaK putative DNA recombination protein; skin element (RefSeq) 130, 371
BSU26290 yqaJ putative nuclease; skin element (RefSeq) 130, 371
BSU26300 yqaI hypothetical protein; skin element (RefSeq) 205, 371
BSU26310 yqaH hypothetical protein; skin element (RefSeq) 88, 371
BSU26320 yqaG putative transcriptional regulator; skin element (RefSeq) 88, 371
BSU30090 yteU putative membrane enzyme for rhamnogalaturonan degradation (RefSeq) 305, 371
BSU30100 yteT putative dehydrogenase of rhamnogalaturonan degradation (RefSeq) 360, 371
BSU30110 yteS putative lipoprotein required for rhamnogalaturonan degradation (RefSeq) 360, 371
BSU30120 yteR unsaturated rhamnogalacturonyl hydrolase (RefSeq) 360, 371
BSU30150 ytdP putative membrane bound transcriptional regulator (AraC/XylS family) (RefSeq) 26, 371
BSU30840 yteA hypothetical protein (RefSeq) 56, 88
BSU37280 narG nitrate reductase (alpha subunit) (RefSeq) 371, 405
BSU37440 ywhL hypothetical protein (RefSeq) 88, 108
BSU38820 yxkF putative transcriptional regulator (RefSeq) 330, 371
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU26320
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend