Organism : Bacillus subtilis | Module List :
BSU34220 epsO

putative pyruvyl transferase (RefSeq)

CircVis
Functional Annotations (1)
Function System
Exopolysaccharide biosynthesis protein cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU34220
(Mouseover regulator name to see its description)

BSU34220 is regulated by 12 influences and regulates 13 modules.
Regulators for BSU34220 epsO (12)
Regulator Module Operator
BSU03960 195 tf
BSU05130 195 tf
BSU29400 195 tf
BSU34220 195 tf
BSU34380 195 tf
BSU35110 195 tf
BSU00330 276 tf
BSU03960 276 tf
BSU04250 276 tf
BSU13450 276 tf
BSU34220 276 tf
BSU34380 276 tf

Warning: BSU34220 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5336 4.90e+01 CATCTCATATTGCGCATTGACCGC
Loader icon
5337 1.90e+02 CCACATATTCTGAAAAGCAGGTAC
Loader icon
5490 2.80e+00 agAT.atgtTctttaAt.agAgct
Loader icon
5491 3.40e+03 cgAAatCaGcCGcgG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU34220

BSU34220 is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Exopolysaccharide biosynthesis protein cog/ cog
Module neighborhood information for BSU34220

BSU34220 has total of 32 gene neighbors in modules 195, 276
Gene neighbors (32)
Gene Common Name Description Module membership
BSU02520 ycbJ putative phosphotransferase (RefSeq) 276, 302
BSU10770 wprA cell wall-associated protease (RefSeq) 125, 276
BSU11980 yjdA 3-ketoacyl-(acyl-carrier-protein) reductase (RefSeq) 23, 276
BSU22040 ypbQ putative integral inner membrane enzyme (RefSeq) 179, 276
BSU22050 bcsA terpene family molecule synthase (RefSeq) 179, 276
BSU24620 tasA major biofilm matrix component (RefSeq) 195, 276
BSU24630 sipW type I signal peptidase (RefSeq) 195, 276
BSU24640 yqxM lipoprotein for biofilm formation (RefSeq) 195, 276
BSU27270 mtn 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (RefSeq) 195, 322
BSU27280 yrrT putative AdoMet-dependent methyltransferase (RefSeq) 150, 195
BSU27290 yrzA hypothetical protein (RefSeq) 195, 322
BSU31670 yuxO putative esterase (RefSeq) 276, 334
BSU34220 epsO putative pyruvyl transferase (RefSeq) 195, 276
BSU34230 epsN putative aminotransferase (RefSeq) 195, 276
BSU34240 epsM putative O-acetyltransferase (RefSeq) 195, 276
BSU34250 epsL putative phosphotransferase involved in extracellular matrix synthesis (RefSeq) 195, 276
BSU34280 epsJ putative glycosyl transferase (RefSeq) 195, 276
BSU34290 epsI putative polysaccharide pyruvyl transferase (RefSeq) 195, 276
BSU34300 epsH putative glycosyltransferase involved in biofilm formation (RefSeq) 195, 276
BSU34310 epsG biofilm extracellular matrix formation enzyme (RefSeq) 195, 276
BSU34320 epsF putative glycosyltransferase involved in extracellular matrix formation (RefSeq) 195, 276
BSU34330 epsE putative glycosyltransferase (RefSeq) 195, 276
BSU34340 epsD putative extracellular matrix biosynthesis enzyme (RefSeq) 195, 276
BSU34350 epsC putative UDP-sugar epimerase (RefSeq) 195, 276
BSU34360 epsB protein tyrosine kinase (RefSeq) 276, 349
BSU34370 epsA modulator of protein tyrosine kinase EpsB (RefSeq) 276, 349
BSU34380 slrR transcriptional regulator (RefSeq) 276, 349
BSU39450 yxeR putative ethanolamine transporter (RefSeq) 80, 276
BSU39460 yxeQ putative catabolic enzyme (RefSeq) 80, 276
BSU39510 yxeL putative acetyltransferase (RefSeq) 80, 276
BSU39940 yxaL membrane associated protein kinase with beta-propeller domain (RefSeq) 189, 276
BSU39950 yxaJ putative integral inner membrane protein (RefSeq) 276, 302
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU34220
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend