Organism : Clostridium acetobutylicum | Module List :
CAC0724

Transcriptional regulator, AcrR family (NCBI ptt file)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulator cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
regulation of transcription, DNA-dependent go/ biological_process
specific transcriptional repressor activity go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC0724
(Mouseover regulator name to see its description)

CAC0724 is regulated by 20 influences and regulates 7 modules.
Regulators for CAC0724 (20)
Regulator Module Operator
CAC0093 132 tf
CAC0197 132 tf
CAC0763 132 tf
CAC0876 132 tf
CAC1333 132 tf
CAC3046 132 tf
CAC3063 132 tf
CAC3487 132 tf
CAC3512 132 tf
CAC3553 132 tf
CAC3651 132 tf
CAC0093 309 tf
CAC0550 309 tf
CAC0723 309 tf
CAC1333 309 tf
CAC1766 309 tf
CAC3433 309 tf
CAC3438 309 tf
CAC3487 309 tf
CAC3651 309 tf

Warning: CAC0724 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
6916 5.30e-03 GGAGgtaa
Loader icon
6917 7.60e+01 CTGTGATTCACATGTGTGACACG
Loader icon
7270 1.50e-04 CACAgaTtTcTtTAttTgTagcAc
Loader icon
7271 4.90e-03 GTGAcaCAcaTGTGctaCacGA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC0724

CAC0724 is enriched for 5 functions in 3 categories.
Module neighborhood information for CAC0724

CAC0724 has total of 39 gene neighbors in modules 132, 309
Gene neighbors (39)
Gene Common Name Description Module membership
CAC0079 CAC0079 Hypothetical protein (NCBI ptt file) 219, 309
CAC0212 CAC0212 Biotin-(acetyl-CoA carboxylase) ligase (NCBI ptt file) 132, 224
CAC0347 CAC0347 Hypothetical protein (NCBI ptt file) 309, 344
CAC0351 CAC0351 Hypothetical protein (NCBI ptt file) 89, 309
CAC0607 CAC0607 Aspartyl aminopeptidase (NCBI ptt file) 287, 309
CAC0631 CAC0631 Signal transduction protein containing diguanylate cyclase/phosphodiesterase domain (GGDEF) and domain (EAL) (NCBI ptt file) 132, 252
CAC0722 CAC0722 Predicted membrane protein; CF-9 family (NCBI ptt file) 4, 309
CAC0723 CAC0723 Transcriptional regulator, AcrR family (NCBI ptt file) 157, 309
CAC0724 CAC0724 Transcriptional regulator, AcrR family (NCBI ptt file) 132, 309
CAC0725 CAC0725 Predicted membrane protein; CF-9 family (NCBI ptt file) 132, 309
CAC0755 CAC0755 Multimeric flavodoxin WrbA family protein, diverged or disrupted (NCBI ptt file) 89, 309
CAC0756 CAC0756 Multimeric flavodoxin WrbA (NCBI ptt file) 157, 309
CAC0763 CAC0763 Transcriptional regulator, MarR family (NCBI ptt file) 132, 322
CAC0772 CAC0772 Cobalt permease (NCBI ptt file) 132, 224
CAC1011 CAC1011 Uncharacterized small membrane protein, homolog of ykvA B.subtilis (NCBI ptt file) 282, 309
CAC1092 CAC1092 Predicted metal-dependent phosphoesterase (PHP family), YciV ortholog (NCBI ptt file) 85, 132
CAC1186 CAC1186 Hypothetical protein (NCBI ptt file) 89, 309
CAC1444 CAC1444 Uncharacterized conserved membrane protein, similar to MDR (VANZ) ORF of Enterococcus (NCBI ptt file) 132, 216
CAC1618 CAC1618 Hypothetical protein (NCBI ptt file) 71, 132
CAC1827 CAC1827 TldD-like protein fragment (NCBI ptt file) 74, 309
CAC2309 CAC2309 DNA modification methyltransferase (NCBI ptt file) 132, 306
CAC2513 CAC2513 Predicted membrane protein (NCBI ptt file) 52, 132
CAC2664 CAC2664 Predicted phosphoesterase, YSNB B.subtilis ortholog (NCBI ptt file) 302, 309
CAC2760 CAC2760 Membrane-associated sensory histidine kinase with HAMP domain (NCBI ptt file) 132, 216
CAC2765 CAC2765 Similar to uncharacterized domain of sensory transducer protein (NCBI ptt file) 176, 309
CAC2900 splB Spore photoproduct lyase, SPL related protein (NCBI ptt file) 132, 351
CAC2949 CAC2949 Predicted permease (NCBI ptt file) 207, 309
CAC2992 CAC2992 Predicted short-chain dehydrogenase (NCBI ptt file) 4, 132
CAC3024 CAC3024 acyl-CoA thioesterase family protein (NCBI ptt file) 216, 309
CAC3025 CAC3025 Conserved membrane protein, possible permease, YHCI B.subtilis ortholog (NCBI ptt file) 157, 309
CAC3293 CAC3293 Uncharacterized conserved membrane protein (NCBI ptt file) 74, 132
CAC3363 CAC3363 Hypothetical protein (NCBI ptt file) 89, 309
CAC3386 CAC3386 Hypothetical protein (NCBI ptt file) 132, 176
CAC3438 CAC3438 Transcriptional regulator, (BlaI/MecI subfamily) (NCBI ptt file) 89, 309
CAC3448 CAC3448 Probable tesA-like protease (NCBI ptt file) 132, 224
CAC3470 CAC3470 Hypothetical protein (NCBI ptt file) 132, 252
CAC3487 CAC3487 Predicted transcriptional regulator (NCBI ptt file) 132, 309
CAC3666 CAC3666 Membrane transporters of cations and cationic drugs (NCBI ptt file) 132, 246
CAC3728 CAC3728 Hypothetical protein (NCBI ptt file) 132, 296
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC0724
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend