Organism : Clostridium acetobutylicum | Module List :
CAC3433

Transcriptional regulators, AcrR family (NCBI ptt file)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulator cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
regulation of transcription, DNA-dependent go/ biological_process
specific transcriptional repressor activity go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC3433
(Mouseover regulator name to see its description)

CAC3433 is regulated by 16 influences and regulates 14 modules.
Regulators for CAC3433 (16)
Regulator Module Operator
CAC0113 344 tf
CAC0457 344 tf
CAC0859 344 tf
CAC1578 344 tf
CAC3406 344 tf
CAC3413 344 tf
CAC3494 344 tf
CAC3512 344 tf
CAC0093 150 tf
CAC0255 150 tf
CAC1280 150 tf
CAC2236 150 tf
CAC3370 150 tf
CAC3433 150 tf
CAC3488 150 tf
CAC3651 150 tf

Warning: CAC3433 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
6952 3.80e-09 gGAGGtaA
Loader icon
6953 6.30e+03 GACTATGTTTGAGAAAATTGAGC
Loader icon
7340 2.50e+03 CcTGgC
Loader icon
7341 2.60e+01 AGGaGtga
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC3433

CAC3433 is enriched for 5 functions in 3 categories.
Module neighborhood information for CAC3433

CAC3433 has total of 50 gene neighbors in modules 150, 344
Gene neighbors (50)
Gene Common Name Description Module membership
CAC0075 CAC0075 Ferredoxin (NCBI ptt file) 69, 150
CAC0124 CAC0124 Hypothetical protein (NCBI ptt file) 108, 150
CAC0133 CAC0133 Hypothetical protein, CF-4 family (NCBI ptt file) 150, 300
CAC0206 CAC0206 Uncharacterized conserved membrane protein (NCBI ptt file) 98, 150
CAC0347 CAC0347 Hypothetical protein (NCBI ptt file) 309, 344
CAC0381 CAC0381 Methyl-accepting chemotaxis protein (NCBI ptt file) 74, 344
CAC0457 CAC0457 Transcriptional regulator, AcrR family (NCBI ptt file) 74, 344
CAC0577 CAC0577 Endo-arabinase related enzyme (family 43 glycosyl hydrolase domain and ricin B-like domain) (NCBI ptt file) 150, 216
CAC0583 CAC0583 CBIK protein (chain A, anaerobic cobalt chelatase) (NCBI ptt file) 117, 344
CAC0647 CAC0647 Predicted membrane protein (NCBI ptt file) 149, 344
CAC0719 CAC0719 Epoxide hydrolase, similar to eukaryotic (NCBI ptt file) 150, 356
CAC0813 CAC0813 Hypothetical protein (NCBI ptt file) 123, 150
CAC0814 CAC0814 3-oxoacyl-[acyl-carrier-protein] synthase III (NCBI ptt file) 244, 344
CAC0859 CAC0859 Ortholog putative anti-SigV factor [Bacillus subtilis] (NCBI ptt file) 69, 344
CAC0881 CAC0881 Hypothetical protein (NCBI ptt file) 267, 344
CAC0955 CAC0955 ATP-dependent Zn protease (NCBI ptt file) 150, 190
CAC1145 CAC1145 Hypothetical protein (NCBI ptt file) 326, 344
CAC1317 CAC1317 Potassium channel subunit (NCBI ptt file) 117, 344
CAC1332 uxuA D-mannonate hydrolase (NCBI ptt file) 150, 169
CAC1359 CAC1359 Predicted xylanase/chitin deacetylase (NCBI ptt file) 150, 190
CAC1458 CAC1458 PTS system, fructose(mannose)-specific IIB (NCBI ptt file) 136, 150
CAC1521 CAC1521 Uncharacterized membrane protein, yetF/ydfS/ykjA/yrbG/ydfR B.subtilis ortholog (NCBI ptt file) 150, 208
CAC1536 CAC1536 Transcriptional regulator, AcrR family (NCBI ptt file) 150, 165
CAC2583 CAC2583 Uncharacterized conserved membrane protein, YHGE B.subtilis homolog (NCBI ptt file) 150, 300
CAC2587 CAC2587 GGDEF domain containing protein (NCBI ptt file) 150, 169
CAC2588 CAC2588 Glycosyltransferase (NCBI ptt file) 150, 169
CAC2596 CAC2596 Rieske FeS-domain containing oxidoreductase (NCBI ptt file) 65, 150
CAC2691 CAC2691 D-lactate dehydrogenase (NCBI ptt file) 150, 338
CAC2705 CAC2705 Uncharacterized membrane protein, homolog of Aquifex (GI:2984271) (NCBI ptt file) 74, 344
CAC2761 CAC2761 Thiamine biosynthesis lipoprotein ApbE (NCBI ptt file) 150, 183
CAC2762 CAC2762 Polyferredoxin (NCBI ptt file) 26, 150
CAC2877 CAC2877 ABC-type iron (III) transport system, ATPase component (NCBI ptt file) 69, 344
CAC3085 CAC3085 TPR-repeat-containing protein; Cell-adhesion domain (NCBI ptt file) 225, 344
CAC3086 CAC3086 Protein containing cell adhesion domain (NCBI ptt file) 225, 344
CAC3168 CAC3168 Predicted membrane protein (NCBI ptt file) 62, 344
CAC3240 CAC3240 Predicted membrane protein (NCBI ptt file) 13, 150
CAC3241 CAC3241 Uncharacterized conserved membrane protein, YYAD B.subtilis ortholog (NCBI ptt file) 150, 301
CAC3332 CAC3332 Predicted amidohydrolase (dihydroorothase family) (NCBI ptt file) 150, 360
CAC3346 CAC3346 MDR-type permease (NCBI ptt file) 4, 150
CAC3361 CAC3361 Transcriptional regulator, LysR family (NCBI ptt file) 150, 240
CAC3370 CAC3370 Predicted transcriptional regulator (NCBI ptt file) 150, 240
CAC3406 CAC3406 Transcriptional regulator, MarR/EmrR family (NCBI ptt file) 140, 344
CAC3413 CAC3413 Transcriptional regulator, MarR/EmrR family (NCBI ptt file) 89, 344
CAC3433 CAC3433 Transcriptional regulators, AcrR family (NCBI ptt file) 150, 344
CAC3434 CAC3434 Hypothetical protein (NCBI ptt file) 205, 344
CAC3494 CAC3494 Transcription regulator, YOBV B.subtilis homolog (NCBI ptt file) 102, 344
CAC3549 CAC3549 Subtilisin-like serine protease (NCBI ptt file) 150, 190
CAC3609 CAC3609 ABC-type MDR transport system, permease component (NCBI ptt file) 26, 150
CAC3610 CAC3610 ABC-type MDR transport system, permease component (NCBI ptt file) 24, 150
CAC3697 CAC3697 Uncharacterized, Zn-finger domain containing protein, YXKC B.subtilis homolog (NCBI ptt file) 123, 150
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC3433
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend