Organism : Clostridium acetobutylicum | Module List:
Module 150 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 150

There are 8 regulatory influences for Module 150

Regulator Table (8)
Regulator Name Type
CAC0255 tf
CAC0093 tf
CAC3370 tf
CAC3488 tf
CAC3433 tf
CAC1280 tf
CAC3651 tf
CAC2236 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
6952 3.80e-09 gGAGGtaA
Loader icon
6953 6.30e+03 GACTATGTTTGAGAAAATTGAGC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 150 is enriched for following functions.

Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 150

There are 31 genes in Module 150

Gene Member Table (31)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
CAC0075 CAC0075 CDS None chromosome 84396 84743 - Ferredoxin (NCBI ptt file) False
CAC0124 CAC0124 CDS None chromosome 134856 135320 - Hypothetical protein (NCBI ptt file) False
CAC0133 CAC0133 CDS None chromosome 141707 142213 - Hypothetical protein, CF-4 family (NCBI ptt file) False
CAC0206 CAC0206 CDS None chromosome 231611 232804 + Uncharacterized conserved membrane protein (NCBI ptt file) False
CAC0577 CAC0577 CDS None chromosome 665101 667131 - Endo-arabinase related enzyme (family 43 glycosyl hydrolase domain and ricin B-like domain) (NCBI ptt file) False
CAC0719 CAC0719 CDS None chromosome 835213 836358 - Epoxide hydrolase, similar to eukaryotic (NCBI ptt file) False
CAC0813 CAC0813 CDS None chromosome 940839 941387 + Hypothetical protein (NCBI ptt file) False
CAC0955 CAC0955 CDS None chromosome 1092609 1094357 - ATP-dependent Zn protease (NCBI ptt file) False
CAC1332 uxuA CDS None chromosome 1471535 1472590 - D-mannonate hydrolase (NCBI ptt file) False
CAC1359 CAC1359 CDS None chromosome 1504760 1505593 + Predicted xylanase/chitin deacetylase (NCBI ptt file) False
CAC1458 CAC1458 CDS None chromosome 1606779 1607273 + PTS system, fructose(mannose)-specific IIB (NCBI ptt file) False
CAC1521 CAC1521 CDS None chromosome 1663975 1664703 - Uncharacterized membrane protein, yetF/ydfS/ykjA/yrbG/ydfR B.subtilis ortholog (NCBI ptt file) False
CAC1536 CAC1536 CDS None chromosome 1680316 1680960 - Transcriptional regulator, AcrR family (NCBI ptt file) True
CAC2583 CAC2583 CDS None chromosome 2686804 2688933 + Uncharacterized conserved membrane protein, YHGE B.subtilis homolog (NCBI ptt file) False
CAC2587 CAC2587 CDS None chromosome 2691448 2692677 - GGDEF domain containing protein (NCBI ptt file) False
CAC2588 CAC2588 CDS None chromosome 2692680 2693459 - Glycosyltransferase (NCBI ptt file) False
CAC2596 CAC2596 CDS None chromosome 2701227 2702672 - Rieske FeS-domain containing oxidoreductase (NCBI ptt file) False
CAC2691 CAC2691 CDS None chromosome 2813991 2814971 + D-lactate dehydrogenase (NCBI ptt file) False
CAC2761 CAC2761 CDS None chromosome 2893667 2894650 + Thiamine biosynthesis lipoprotein ApbE (NCBI ptt file) False
CAC2762 CAC2762 CDS None chromosome 2894650 2895807 + Polyferredoxin (NCBI ptt file) False
CAC3240 CAC3240 CDS None chromosome 3389123 3390214 - Predicted membrane protein (NCBI ptt file) False
CAC3241 CAC3241 CDS None chromosome 3390366 3391418 + Uncharacterized conserved membrane protein, YYAD B.subtilis ortholog (NCBI ptt file) False
CAC3332 CAC3332 CDS None chromosome 3504817 3505998 - Predicted amidohydrolase (dihydroorothase family) (NCBI ptt file) False
CAC3346 CAC3346 CDS None chromosome 3518656 3520074 + MDR-type permease (NCBI ptt file) False
CAC3361 CAC3361 CDS None chromosome 3539488 3540426 - Transcriptional regulator, LysR family (NCBI ptt file) True
CAC3370 CAC3370 CDS None chromosome 3547300 3547827 - Predicted transcriptional regulator (NCBI ptt file) True
CAC3433 CAC3433 CDS None chromosome 3622062 3622619 + Transcriptional regulators, AcrR family (NCBI ptt file) True
CAC3549 CAC3549 CDS None chromosome 3744425 3745618 + Subtilisin-like serine protease (NCBI ptt file) False
CAC3609 CAC3609 CDS None chromosome 3811057 3811797 + ABC-type MDR transport system, permease component (NCBI ptt file) False
CAC3610 CAC3610 CDS None chromosome 3811797 3812789 + ABC-type MDR transport system, permease component (NCBI ptt file) False
CAC3697 CAC3697 CDS None chromosome 3902422 3902727 - Uncharacterized, Zn-finger domain containing protein, YXKC B.subtilis homolog (NCBI ptt file) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 150

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.