Organism : Campylobacter jejuni | Module List :
Cj0466

putative transcriptional regulator (NCBI ptt file)

CircVis
Functional Annotations (1)
Function System
cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Cj0466
(Mouseover regulator name to see its description)

Cj0466 is regulated by 10 influences and regulates 7 modules.
Regulators for Cj0466 (10)
Regulator Module Operator
Cj0123c 17 tf
Cj0466 17 tf
Cj0480c 17 tf
Cj0670 17 tf
Cj1273c 17 tf
Cj0322 9 tf
Cj0466 9 tf
Cj0757 9 tf
Cj1349c 9 tf
Cj1595 9 tf

Warning: Cj0466 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7400 2.00e+01 tcgggTtcAAttccctcaAggAGa
Loader icon
7401 6.90e+02 GGTAGAGCAccccCcTtGTAAGc
Loader icon
7416 9.90e+01 AgCctaAg.ca
Loader icon
7417 3.40e+03 CTGTCTTCATAGTATAAAACCG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Cj0466

Cj0466 is enriched for 1 functions in 3 categories.
Module neighborhood information for Cj0466

Cj0466 has total of 45 gene neighbors in modules 9, 17
Gene neighbors (45)
Gene Common Name Description Module membership
Cj0037c Cj0037c putative cytochrome c (NCBI ptt file) 9, 159
Cj0123c Cj0123c putative transcriptional regulator (NCBI ptt file) 17, 29
Cj0125c Cj0125c dksA-like protein (NCBI ptt file) 17, 23
Cj0126c Cj0126c hypothetical protein Cj0126c (NCBI ptt file) 17, 68
Cj0166 miaA tRNA delta(2)-isopentenylpyrophosphate transferase (NCBI ptt file) 17, 152
Cj0170 Cj0170 hypothetical protein (NCBI) 9, 115
Cj0239c Cj0239c nifU protein homolog (NCBI ptt file) 9, 115
Cj0293 surE SurE protein homolog (NCBI ptt file) 17, 129
Cj0363c Cj0363c putative oxidoreductase (NCBI ptt file) 17, 57
Cj0376 Cj0376 putative periplasmic protein (NCBI ptt file) 13, 17
Cj0466 Cj0466 putative transcriptional regulator (NCBI ptt file) 9, 17
Cj0470 tuf elongation factor TU (NCBI ptt file) 9, 30
Cj0471 rpmG 50S ribosomal protein L33 (NCBI ptt file) 9, 30
Cj0478 rpoB DNA-directed RNA polymerase beta chain (NCBI ptt file) 9, 146
Cj0650 Cj0650 putative ATP /GTP binding protein (NCBI ptt file) 7, 17
Cj0679 kdpD' truncated KdpD protein (NCBI ptt file) 17, 54
Cj0760 Cj0760 hypothetical protein Cj0760 (NCBI ptt file) 9, 156
Cj0830 Cj0830 putative integral membrane protein (NCBI ptt file) 9, 115
Cj0856 lepP signal peptidase I (NCBI ptt file) 17, 43
Cj0862c pabB para-aminobenzoate synthase component I (NCBI ptt file) 17, 89
Cj0943 Cj0943 putative periplasmic protein (NCBI ptt file) 17, 77
Cj1027c gyrA DNA gyrase subunit A (NCBI ptt file) 9, 83
Cj1071 ssb single-strand DNA binding protein (NCBI ptt file) 9, 138
Cj1078 Cj1078 putative periplasmic protein (NCBI ptt file) 17, 72
Cj1108 clpA ATP-dependent CLP protease ATP-binding subunit (NCBI ptt file) 17, 153
Cj1116c ftsH membrane bound zinc metallopeptidase (NCBI ptt file) 17, 131
Cj1182c rpsB 30S ribosomal protein S2 (NCBI ptt file) 9, 30
Cj1189c Cj1189c putative signal-transduction sensor protein (NCBI ptt file) 9, 153
Cj1190c Cj1190c putative MCP-domain signal transduction protein (NCBI ptt file) 9, 115
Cj1220 groES 10 kD chaperonin (cpn10) (NCBI ptt file) 9, 42
Cj1221 groEL 60 kD chaperonin (cpn60) (NCBI ptt file) 9, 121
Cj1226c Cj1226c putative two-component sensor (NCBI ptt file) 17, 64
Cj1229 cbpA putative curved-DNA binding protein (NCBI ptt file) 17, 64
Cj1231 kefB putative glutathione-regulated potassium-efflux system protein (NCBI ptt file) 17, 64
Cj1233 Cj1233 putative hydrolase (NCBI ptt file) 17, 64
Cj1247c Cj1247c hypothetical protein Cj1247c (NCBI ptt file) 7, 17
Cj1334 Cj1334 hypothetical prootein Cj1334 (1318 family) (NCBI ptt file) 17, 121
Cj1378 selA L-seryl-tRNA(SeC) selenium transferase (NCBI ptt file) 17, 159
Cj1389 Cj1389 None 9, 115
Cj1426c Cj1426c hypothetical protein Cj1426c (NCBI ptt file) 17, 36
Cj1591 rpmJ 50S ribosomal protein L36 (NCBI ptt file) 9, 30
Cj1596 rplQ 50S ribosomal protein L17 (NCBI ptt file) 9, 111
Cj1684c Cj1684c putative transmembrane transport protein (NCBI ptt file) 17, 117
Cj1716c leuD putative 3-isopropylmalate dehydratase small subunit (NCBI ptt file) 17, 70
Cjp07 tRNA-Tyr tRNA-Tyr (NCBI) 9, 73
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Cj0466
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend