Organism : Campylobacter jejuni | Module List :
Cj1349c

possible fibronectin/fibrinogen-binding protein (NCBI ptt file)

CircVis
Functional Annotations (1)
Function System
Predicted RNA-binding protein homologous to eukaryotic snRNP cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Cj1349c
(Mouseover regulator name to see its description)

Cj1349c is regulated by 4 influences and regulates 8 modules.
Regulators for Cj1349c (4)
Regulator Module Operator
Cj0101 47 tf
Cj0382c 47 tf
Cj0400 47 tf
Cj1349c 47 tf

Warning: Cj1349c Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7476 8.30e+02 Gt.atGGc..atcT.GC.GgaTcG
Loader icon
7477 1.70e+03 GgctcaTaaGtTcttt.at.TTG
Loader icon
7566 4.10e+02 GGCGAATTTTGTGGTAGAATTAC
Loader icon
7567 3.70e+03 CAGCTTAATGAGC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Cj1349c

Cj1349c is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Predicted RNA-binding protein homologous to eukaryotic snRNP cog/ cog
Module neighborhood information for Cj1349c

Cj1349c has total of 47 gene neighbors in modules 47, 92
Gene neighbors (47)
Gene Common Name Description Module membership
Cj0086c ung uracil-DNA glycosylase (NCBI ptt file) 18, 47
Cj0188c Cj0188c hypothetical protein Cj0188c (NCBI ptt file) 7, 47
Cj0246c Cj0246c putative MCP-domain signal transduction protein (NCBI ptt file) 47, 88
Cj0248 Cj0248 hypothetical protein Cj0248 (NCBI ptt file) 47, 88
Cj0447 Cj0447 hypothetical protein Cj0447 (NCBI ptt file) 41, 47
Cj0505c Cj0505c putative aminotransferase (degT family) (NCBI ptt file) 47, 88
Cj0517 crcB CRCB protein homolog (NCBI ptt file) 47, 138
Cj0594c Cj0594c putative periplasmic protein (NCBI ptt file) 89, 92
Cj0600 Cj0600 hypothetical protein Cj0600 (NCBI ptt file) 92, 162
Cj0661c era GTP-binding protein ERA homolog (NCBI ptt file) 47, 117
Cj0777 Cj0777 putative ATP-dependent DNA helicase (NCBI ptt file) 26, 47
Cj0901 Cj0901 putative amino acid ABC tansporter permease protein (NCBI ptt file) 92, 127
Cj0939c Cj0939c hypothetical protein Cj0939c (NCBI ptt file) 47, 132
Cj0951c Cj0951c putative MCP-domain signal transduction protein (NCBI ptt file) 47, 122
Cj0958c Cj0958c putative membrane protein (NCBI ptt file) 26, 47
Cj0959c Cj0959c hypothetical protein Cj0959c (NCBI ptt file) 46, 47
Cj0960c rnpA putative ribonuclease P protein component (NCBI ptt file) 47, 135
Cj0961c rpmH 50S ribosomal protein L34 (NCBI ptt file) 47, 103
Cj0962 Cj0962 putative acetyltransferase (NCBI ptt file) 47, 60
Cj0969 Cj0969 None 47, 56
Cj0981c Cj0981c transmembrane transport protein (NCBI ptt file) 26, 47
Cj1011 Cj1011 putative membrane protein (NCBI ptt file) 47, 132
Cj1012c Cj1012c putative membrane protein (NCBI ptt file) 47, 117
Cj1018c livK branched-chain amino-acid ABC transport system periplasmic binding protein (NCBI ptt file) 34, 47
Cj1141 neuB1 N-acetylneuraminic acid synthetase (NCBI ptt file) 24, 92
Cj1154c Cj1154c small hydrophobic protein (NCBI ptt file) 47, 127
Cj1195c pyrC2 putative dihydroorotase (NCBI ptt file) 47, 162
Cj1208 Cj1208 hypothetical protein Cj1208 (NCBI ptt file) 92, 128
Cj1340c Cj1340c hypothetical protein Cj1340c (1318 family) (NCBI ptt file) 92, 124
Cj1341c Cj1341c hypothetical protein Cj1341c (1318 family) (NCBI ptt file) 92, 117
Cj1342c Cj1342c hypothetical protein Cj1342c (617 family) (NCBI ptt file) 92, 124
Cj1343c Cj1343c putative periplasmic protein (NCBI ptt file) 92, 106
Cj1344c Cj1344c putative glycoprotease (NCBI ptt file) 92, 149
Cj1345c Cj1345c putative periplasmic protein (NCBI ptt file) 11, 92
Cj1346c dxr putative 1-deoxy-D-xylulose 5-phosphate reductoisomerase (NCBI ptt file) 47, 92
Cj1347c cdsA phosphatidate cytidylyltransferase (NCBI ptt file) 11, 92
Cj1348c Cj1348c putative coiled-coil protein (NCBI ptt file) 75, 92
Cj1349c Cj1349c possible fibronectin/fibrinogen-binding protein (NCBI ptt file) 47, 92
Cj1350 mobA putative molybdopterin-guanine dinucleotide biosynthesis protein (NCBI ptt file) 92, 124
Cj1392 metC' putative cystathionine beta-lyase, N-terminus (RefSeq) 16, 47
Cj1421c Cj1421c possible sugar transferase (NCBI ptt file) 92, 99
Cj1470c Cj1470c None 47, 107
Cj1484c Cj1484c putative membrane protein (NCBI ptt file) 79, 92
Cj1563c Cj1563c putative transcriptional regulator (NCBI ptt file) 59, 92
Cj1640 Cj1640 hypothetical protein Cj1640 (NCBI ptt file) 92, 102
Cj1646 iamB putative ABC transport system permease protein (NCBI ptt file) 7, 92
Cj1668c Cj1668c putative periplasmic protein (NCBI ptt file) 92, 132
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Cj1349c
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend