Organism : Desulfovibrio vulgaris Hildenborough | Module List :
DVU1768

GTP-binding protein

CircVis
Functional Annotations (4)
Function System
Predicted GTPases cog/ cog
GTP binding go/ molecular_function
intracellular go/ cellular_component
small_GTP tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for DVU1768
(Mouseover regulator name to see its description)

DVU1768 is regulated by 22 influences and regulates 0 modules.
Regulators for DVU1768 (22)
Regulator Module Operator
DVU0230 261 tf
DVU0379
DVU0525
261 combiner
DVU0629 261 tf
DVU0653
DVU2251
261 combiner
DVU0936 261 tf
DVU1754 261 tf
DVU1754
DVU0379
261 combiner
DVU1788
DVU0230
261 combiner
DVU2394
DVU2251
261 combiner
DVU2557
DVU0936
261 combiner
DVU2686
DVU2960
261 combiner
DVUA0024 261 tf
DVU0379
DVU2934
95 combiner
DVU0569 95 tf
DVU0679
DVU2934
95 combiner
DVU1674
DVU1402
95 combiner
DVU1674
DVU1517
95 combiner
DVU1674
DVU2956
95 combiner
DVU1674
DVU3095
95 combiner
DVU2359
DVU2934
95 combiner
DVU2423
DVU3095
95 combiner
DVU3381 95 tf

Warning: DVU1768 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.
Click on the RegPredict links to explore the motif in RegPredict.

Motif Table (4)
Motif Id e-value Consensus Motif Logo RegPredict
183 8.10e+02 TTTTTCa
Loader icon
RegPredict
184 4.60e+02 tgCcGcCcTgccGaCA
Loader icon
RegPredict
497 1.40e+03 GcTgTtCa
Loader icon
RegPredict
498 1.20e+04 ACAGCAGACCCATGCGGAGGACAC
Loader icon
RegPredict
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for DVU1768

DVU1768 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Predicted GTPases cog/ cog
GTP binding go/ molecular_function
intracellular go/ cellular_component
small_GTP tigr/ tigrfam
Module neighborhood information for DVU1768

DVU1768 has total of 37 gene neighbors in modules 95, 261
Gene neighbors (37)
Gene Common Name Description Module membership
DVU0026 hypothetical protein DVU0026 247, 261
DVU0075 aminotransferase 95, 251
DVU0085 trpB-1 tryptophan synthase subunit beta 5, 95
DVU0116 polysaccharide deacetylase family protein 95, 183
DVU0143 hypothetical protein DVU0143 95, 137
DVU0144 cytidyltransferase-like protein 25, 95
DVU0164 cation efflux family protein 109, 261
DVU0272 hypothetical protein DVU0272 51, 261
DVU0329 hypothetical protein DVU0329 106, 261
DVU0436 TetR family transcriptional regulator 68, 261
DVU1071 hypothetical protein DVU1071 65, 261
DVU1134 hupB DNA-binding protein HU subunit beta 95, 183
DVU1281 hypothetical protein DVU1281 95, 294
DVU1667 FtsK/SpoIIIE family protein 51, 261
DVU1763 hypothetical protein DVU1763 25, 261
DVU1764 hypothetical protein DVU1764 113, 261
DVU1765 thiH thiamine biosynthesis protein ThiH 95, 261
DVU1766 aspartate ammonia-lyase 124, 261
DVU1767 biotin synthase 95, 261
DVU1768 GTP-binding protein 95, 261
DVU1799 fusA-2 elongation factor G 95, 271
DVU1802 hypothetical protein DVU1802 26, 261
DVU1856 hypothetical protein DVU1856 144, 261
DVU1882 HDIG domain-containing protein 95, 249
DVU1956 heptosyltransferase family protein 137, 261
DVU2268 hypothetical protein DVU2268 31, 261
DVU2277 hypothetical protein DVU2277 261, 341
DVU2301 lipoprotein 92, 261
DVU2311 None 37, 261
DVU2350 gid tRNA (uracil-5-)-methyltransferase Gid 25, 261
DVU2466 flocculin repeat-containing protein 51, 261
DVU2760 hypothetical protein DVU2760 25, 261
DVU2772 hypothetical protein DVU2772 160, 261
DVU2909 MarR family transcriptional regulator 57, 261
DVU3012 hypothetical protein DVU3012 95, 112
DVU3202 TatD family hydrolase 57, 261
DVU3366 def polypeptide deformylase 227, 261
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for DVU1768
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend