Organism : Desulfovibrio vulgaris Hildenborough | Module List :
DVU2799

MarR family transcriptional regulator

CircVis
Functional Annotations (4)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for DVU2799
(Mouseover regulator name to see its description)

DVU2799 is regulated by 19 influences and regulates 19 modules.
Regulators for DVU2799 (19)
Regulator Module Operator
DVU0946 303 tf
DVU0946
DVU1144
303 combiner
DVU2114 303 tf
DVU2836
DVU3023
303 combiner
DVU3023 303 tf
DVU3167 303 tf
DVU3167
DVU2114
303 combiner
DVU3186 303 tf
DVU3186
DVU0110
303 combiner
DVU3193
DVU0946
303 combiner
DVU3255
DVU3186
303 combiner
DVU1754 272 tf
DVU2114 272 tf
DVU2686 272 tf
DVU2836 272 tf
DVU2836
DVU3193
272 combiner
DVU2909 272 tf
DVU2960
DVU0916
272 combiner
DVU3186 272 tf

Warning: DVU2799 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.
Click on the RegPredict links to explore the motif in RegPredict.

Motif Table (4)
Motif Id e-value Consensus Motif Logo RegPredict
519 1.20e-01 GCACACAAAcgtCaaaa.AatCcG
Loader icon
RegPredict
520 1.80e+00 AtGTtAttTTatCTTGaTtgCAAA
Loader icon
RegPredict
579 1.30e-04 CA.gGTtTtttTacAgcaAtG
Loader icon
RegPredict
580 3.60e+00 AAGATAAAATAACATCTTATTTAT
Loader icon
RegPredict
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for DVU2799

DVU2799 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for DVU2799

DVU2799 has total of 35 gene neighbors in modules 272, 303
Gene neighbors (35)
Gene Common Name Description Module membership
DVU0129 sensory box protein 272, 285
DVU0222 hypothetical protein DVU0222 272, 343
DVU0629 TetR family transcriptional regulator 132, 272
DVU0656 hypothetical protein DVU0656 63, 303
DVU0657 HSP20 family protein 164, 303
DVU0677 transglycosylase 135, 272
DVU0690 hypothetical protein DVU0690 272, 332
DVU0713 branched-chain amino acid ABC transporter permease 303, 347
DVU0720 HAMP domain-containing protein 272, 296
DVU0722 response regulator 268, 272
DVU0940 GGDEF domain-containing protein 214, 303
DVU1376 ilvB-2 acetolactate synthase large subunit, biosynthetic type 117, 303
DVU1440 rnc ribonuclease III 135, 272
DVU1462 cytochrome c assembly protein 117, 303
DVU1464 heptosyltransferase family protein 117, 303
DVU1650 hypothetical protein DVU1650 300, 303
DVU1651 hypothetical protein DVU1651 128, 303
DVU1682 GAF domain-containing protein 163, 303
DVU2180 hypothetical protein DVU2180 233, 272
DVU2323 hypothetical protein DVU2323 164, 303
DVU2351 hypothetical protein DVU2351 132, 272
DVU2443 hypothetical protein DVU2443 272, 343
DVU2608 motA-3 flagellar motor protein MotA 88, 303
DVU2633 transcriptional regulator 272, 285
DVU2747 hypothetical protein DVU2747 135, 272
DVU2799 MarR family transcriptional regulator 272, 303
DVU2800 heavy metal translocating P-type ATPase 272, 303
DVU2801 hypothetical protein DVU2801 272, 303
DVU2835 transcriptional regulator 245, 272
DVU2847 hypothetical protein DVU2847 272, 343
DVU2933 response regulator/sensory box/HDIG domain-containing protein 135, 272
DVU3016 B12 binding /radical SAM domain-containing protein 135, 272
DVU3085 hypothetical protein DVU3085 88, 303
DVU3261 frdC fumarate reductase, cytochrome subunit B 48, 303
DVU3356 NAD-dependent epimerase/dehydratase family protein 268, 303
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for DVU2799
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend