Organism : Halobacterium salinarum NRC-1 | Module List :
VNG0243Cm truD

tRNA pseudouridine synthase D

CircVis
Functional Annotations (6)
Function System
Uncharacterized conserved protein cog/ cog
RNA binding go/ molecular_function
pseudouridylate synthase activity go/ molecular_function
pseudouridine synthase activity go/ molecular_function
tRNA pseudouridine synthesis go/ biological_process
tRNA_TruD_broad tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG0243Cm
(Mouseover regulator name to see its description)

VNG0243Cm is regulated by 24 influences and regulates 0 modules.
Regulators for VNG0243Cm truD (24)
Regulator Module Operator
VNG0835G 209 tf
VNG1405C 209 tf
VNG1405C
VNG5176C
209 combiner
VNG6143H 209 tf
VNG6389G 209 tf
VNG0147C
VNG1405C
298 combiner
VNG0835G 298 tf
VNG0835G
VNG1405C
298 combiner
VNG0835G
VNG6288C
298 combiner
VNG1405C 298 tf
VNG5176C
VNG6288C
298 combiner
VNG6193H 298 tf
VNG6389G 298 tf
VNG1215G
VNG0462C
130 combiner
VNG1237C 130 tf
VNG1510C
VNG6288C
130 combiner
VNG6143H 130 tf
VNG6438G
VNG0389C
130 combiner
VNG0826C
VNG5176C
86 combiner
VNG0835G
VNG6288C
86 combiner
VNG1548C 86 tf
VNG5176C
VNG6288C
86 combiner
VNG6193H 86 tf
VNG6389G 86 tf

Warning: VNG0243Cm Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
1147 3.00e-06 .taatctatgcagAaActaTttat
Loader icon
1148 5.90e+01 AAAAGAGTTACGAATTTCGTA
Loader icon
1233 9.10e+03 TGAAAA
Loader icon
1234 2.30e+04 TACAAaCA
Loader icon
1367 7.00e-06 AgAaAt.aTTtatactccactAa.
Loader icon
1368 9.40e+00 aATTTCGtaAcTAaGCTAcgA
Loader icon
1517 1.40e-04 AAataTt.ttTTcG.tgCttagaT
Loader icon
1518 6.00e+02 CAgT..tgcACGAcaTCGACcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG0243Cm

VNG0243Cm is enriched for 6 functions in 3 categories.
Enrichment Table (6)
Function System
Uncharacterized conserved protein cog/ cog
RNA binding go/ molecular_function
pseudouridylate synthase activity go/ molecular_function
pseudouridine synthase activity go/ molecular_function
tRNA pseudouridine synthesis go/ biological_process
tRNA_TruD_broad tigr/ tigrfam
Module neighborhood information for VNG0243Cm

VNG0243Cm has total of 46 gene neighbors in modules 86, 130, 209, 298
Gene neighbors (46)
Gene Common Name Description Module membership
VNG0117H hypothetical protein VNG0117H 72, 207, 209, 243, 298
VNG0138H hypothetical protein VNG0138H 57, 209, 298
VNG0240C hypothetical protein VNG0240C 130
VNG0243Cm truD tRNA pseudouridine synthase D 86, 130, 209, 298
VNG0298H hypothetical protein VNG0298H 57, 269, 298
VNG0301C nicotinamide-nucleotide adenylyltransferase 57, 298
VNG0407H hypothetical protein VNG0407H 139, 298
VNG0498C hypothetical protein VNG0498C 139, 298
VNG0499G cna proliferating-cell nucleolar antigen 57, 86, 139, 209, 298
VNG0595H hypothetical protein VNG0595H 139, 209, 298
VNG0622H hypothetical protein VNG0622H 139, 209, 298
VNG0720G dip2 DNA damage-inducible protein 130
VNG0818C hypothetical protein VNG0818C 86, 106, 243, 298
VNG0875Cm Zn-dependent protease 139, 298
VNG0938G gufA GufA protein 57, 86, 139, 209, 298
VNG1260C hypothetical protein VNG1260C 130, 132, 133
VNG1317H hypothetical protein VNG1317H 130, 246
VNG1394H hypothetical protein VNG1394H 86, 209, 214, 298
VNG1455H hypothetical protein VNG1455H 26, 31, 57, 86
VNG1470G pri DNA primase small subunit 139, 298
VNG1508C hypothetical protein VNG1508C 130
VNG1574G cobI cobalamin adenosyltransferase 86, 210
VNG1785G panF hypothetical protein VNG1785G 57, 86, 232, 243, 298
VNG1788C hypothetical protein VNG1788C 186, 209
VNG1815G carA carbamoyl phosphate synthase small subunit 68, 86, 209, 257, 294, 298
VNG1816G trh3 transcription regulator 68, 86, 139, 209, 238, 257, 298
VNG1818G idi Idi 68, 86, 209, 214, 234, 257
VNG1917H hypothetical protein VNG1917H 139, 209, 298
VNG1957G tgtA2 archaeosine tRNA-ribosyltransferase 118, 129, 130, 132
VNG1959G tgtA1 7-cyano-7-deazaguanine tRNA-ribosyltransferase 53, 129, 130, 132, 133
VNG2025G yyaI acetyltransferase-like protein 130
VNG2087G hisH imidazole glycerol phosphate synthase subunit HisH 86, 106, 209, 298
VNG2156C hypothetical protein VNG2156C 57, 106, 209, 243, 298
VNG2270G mutS3 hypothetical protein VNG2270G 57, 86, 298
VNG2335H hypothetical protein VNG2335H 57, 86, 106, 139, 209, 257, 298
VNG6143H hypothetical protein VNG6143H 5, 26, 31, 72, 86, 106, 204, 232, 243, 295, 298
VNG6145H hypothetical protein VNG6145H 31, 72, 86, 106, 232, 298
VNG6288C hypothetical protein VNG6288C 209
VNG6339H hypothetical protein VNG6339H 26, 31, 69, 86, 106, 204, 232
VNG6348H hypothetical protein VNG6348H 85, 86, 106, 160, 209
VNG6365H hypothetical protein VNG6365H 86, 209
VNG7047 hypothetical protein VNG7047 57, 86, 209, 216, 298
VNG7056 hypothetical protein VNG7056 86, 105, 106, 186, 209, 232, 238, 243, 257, 298
VNG7099 hypothetical protein VNG7099 57, 209
VNG7117 hypothetical protein VNG7117 86, 106
VNG7127 hypothetical protein VNG7127 86, 106, 209, 257, 298
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG0243Cm
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend