Organism : Halobacterium salinarum NRC-1 | Module List :
VNG1918C

geranylgeranylglyceryl phosphate synthase-like protein

CircVis
Functional Annotations (2)
Function System
Predicted phosphate-binding enzymes, TIM-barrel fold cog/ cog
GGGP-family tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG1918C
(Mouseover regulator name to see its description)

VNG1918C is regulated by 15 influences and regulates 0 modules.
Regulators for VNG1918C (15)
Regulator Module Operator
VNG1237C 53 tf
VNG2112C 53 tf
VNG6143H 53 tf
VNG1237C 13 tf
VNG2112C 13 tf
VNG6143H 13 tf
VNG6287H 13 tf
VNG6438G 13 tf
VNG1510C 20 tf
VNG1548C 20 tf
VNG2112C 20 tf
VNG6143H 20 tf
VNG1179C 60 tf
VNG1237C 60 tf
VNG6143H 60 tf

Warning: VNG1918C Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
1005 1.20e+01 CGaccgagagGAacgcgtGGA
Loader icon
1006 8.20e+00 GTtTGAgGTGcgtGAcACGATTC
Loader icon
1019 5.40e+03 tTCtGTTC
Loader icon
1020 2.80e+03 gCGaCgGcGAG
Loader icon
1081 1.00e-01 gtcctCGaCGcgctcCTcGc.Gt
Loader icon
1082 2.50e-01 CGtc.gCgAC.gCGa
Loader icon
1095 1.40e+00 Cagcgacc.ggcgtTcctc.ctgt
Loader icon
1096 2.70e+02 AACGAATCGTGTCACGCACCTCAA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG1918C

VNG1918C is enriched for 2 functions in 3 categories.
Enrichment Table (2)
Function System
Predicted phosphate-binding enzymes, TIM-barrel fold cog/ cog
GGGP-family tigr/ tigrfam
Module neighborhood information for VNG1918C

VNG1918C has total of 55 gene neighbors in modules 13, 20, 53, 60
Gene neighbors (55)
Gene Common Name Description Module membership
VNG0157G oxlT oxalate/formate antiporter 53, 265
VNG0216H hypothetical protein VNG0216H 4, 13, 15, 20, 32, 43, 92, 93, 94, 103, 104, 105
VNG0217H hypothetical protein VNG0217H 13, 15, 20, 32, 43, 53, 92, 93, 94, 103, 105
VNG0596H hypothetical protein VNG0596H 53
VNG0731H hypothetical protein VNG0731H 43, 53, 164
VNG1000H hypothetical protein VNG1000H 20, 26, 31, 232
VNG1050H hypothetical protein VNG1050H 28, 53, 60
VNG1066C hypothetical protein VNG1066C 13, 96, 102, 108
VNG1299C hypothetical protein VNG1299C 53, 285
VNG1395G htr9 Htr9 13, 60, 281
VNG1520G mutY A/G specific adenine glycosylase, repair protein 4, 5, 53
VNG1577C hypothetical protein VNG1577C 20, 53, 96, 140, 173
VNG1580H hypothetical protein VNG1580H 20, 53, 140, 173, 277
VNG1581C hypothetical protein VNG1581C 20, 140, 173
VNG1582G hisC2 hypothetical protein VNG1582G 20, 53, 96, 140, 173
VNG1590H hypothetical protein VNG1590H 13, 281
VNG1622G rfcB replication factor C large subunit 5, 28, 53, 140
VNG1681C hypothetical protein VNG1681C 20, 26, 28, 31, 147, 232
VNG1682C ubiA prenyltransferase 20
VNG1687C hypothetical protein VNG1687C 20, 249
VNG1781C hypothetical protein VNG1781C 21, 53, 60
VNG1783H hypothetical protein VNG1783H 53
VNG1902H hypothetical protein VNG1902H 53
VNG1918C geranylgeranylglyceryl phosphate synthase-like protein 13, 20, 53, 60
VNG1953C hypothetical protein VNG1953C 13, 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1959G tgtA1 7-cyano-7-deazaguanine tRNA-ribosyltransferase 53, 129, 130, 132, 133
VNG1971G gpdB anaerobic glycerol-3-phosphate dehydrogenase subunit B 20, 44
VNG1976H hypothetical protein VNG1976H 26, 31, 60
VNG2096G cctB thermosome subunit beta 4, 5, 28, 53, 140, 173
VNG2100G iluA threonine dehydratase 5, 20, 26, 28
VNG2112C hypothetical protein VNG2112C 60, 166, 167, 169
VNG2214G dinF DNA damage-inducible protein 53, 60, 173
VNG2242C hypothetical protein VNG2242C 53
VNG2386C hypothetical protein VNG2386C 13, 28
VNG2466C None 13, 31, 64, 70, 166
VNG2586C F420-0--gamma-glutamyl ligase 53, 206
VNG5073H None 13
VNG6150G orc1 orc / cell division control protein 6 4, 13, 38, 142, 189
VNG6152H hypothetical protein VNG6152H 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
VNG6170H hypothetical protein VNG6170H 4, 5, 15, 26, 28, 31, 36, 53, 60, 63, 69, 72, 85, 122
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6244G gvpN2 GvpN protein, cluster B 5, 26, 53, 185
VNG6375H hypothetical protein VNG6375H 13, 60, 121, 189
VNG6377H hypothetical protein VNG6377H 13, 60, 121, 189
VNG6378H hypothetical protein VNG6378H 13, 21, 53, 60, 121, 189, 281
VNG6383G lctP L-lactate permease 8, 13, 14
VNG6384H hypothetical protein VNG6384H 20, 131, 160, 232
VNG6416H hypothetical protein VNG6416H 13, 15, 21, 41, 60, 281
VNG6418H hypothetical protein VNG6418H 13, 18, 21, 41, 60, 281
VNG6419H hypothetical protein VNG6419H 13, 21, 60, 281
VNG6424H hypothetical protein VNG6424H 13, 15, 189
VNG7046 hypothetical protein VNG7046 13, 212, 216
VNG7052 hypothetical protein VNG7052 13
VNG7128 hypothetical protein VNG7128 21, 60, 281
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG1918C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend