Organism : Halobacterium salinarum NRC-1 | Module List:
Module 25 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 25

There are 6 regulatory influences for Module 25

Regulator Table (6)
Regulator Name Type
VNG1899G
VNG2243G
combiner
VNG2441G
VNG2641H
combiner
VNG0194H tf
VNG2243G
VNG0293H
combiner
VNG1899G
VNG2641H
combiner
VNG0458G
VNG2641H
combiner

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
1027 8.00e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1028 5.20e+02 GgGTtcCcGtcgGaGgCaAAaAC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 25 is enriched for following functions.

GO Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
electron transport biological_process 4.17e-04 1.11e-03 5/29

TIGRFam Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Biosynthesis of cofactors, prosthetic groups, and carriers tigr mainrole 2.84e-03 1.04e-02 3/29
Biosynthesis of cofactors, prosthetic groups, and carriers tigr mainrole 2.84e-03 4.01e-03 3/29

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Function unknown cog subcategory 4.41e-04 6.91e-03 7/29
Cellular processes and signaling cog category 3.09e-02 4.59e-02 6/29
Poorly characterized cog category 1.25e-02 2.01e-02 9/29
Posttranslational modification, protein turnover, chaperones cog subcategory 1.26e-02 2.02e-02 3/29
Coenzyme transport and metabolism cog subcategory 3.20e-02 4.74e-02 3/29
Function unknown cog subcategory 4.41e-04 8.81e-04 7/29
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 25

There are 29 genes in Module 25

Gene Member Table (29)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
VNG0227H CDS 1447141 chromosome 192372 192635 - hypothetical protein VNG0227H False
VNG0254G tfbG CDS 1447159 chromosome 208286 209257 - transcription initiation factor IIB True
VNG0261H CDS 1447164 chromosome 211694 211852 + hypothetical protein VNG0261H False
VNG0262C CDS 1447165 chromosome 211896 213011 + hypothetical protein VNG0262C False
VNG0321G ids CDS 1447206 chromosome 251940 253118 - Ids False
VNG0533H CDS 1447361 chromosome 410415 411128 + hypothetical protein VNG0533H False
VNG0932C CDS 1447666 chromosome 710638 711030 + hypothetical protein VNG0932C False
VNG0940Gm ACS3 CDS 1449030 chromosome 716669 718771 + Acetyl-CoA synthetase False
VNG0955G fapE CDS 1447682 chromosome 728962 729432 - flagella-like protein E False
VNG1264C CDS 1447921 chromosome 950936 951319 - hypothetical protein VNG1264C False
VNG1273G moaC CDS 1447927 chromosome 956875 957366 + putative molybdenum cofactor biosynthesis protein MoaC False
VNG1326H CDS 1447967 chromosome 991743 992111 + hypothetical protein VNG1326H False
VNG1446H CDS 1448052 chromosome 1071909 1072142 - hypothetical protein VNG1446H False
VNG1663C CDS 1448215 chromosome 1239515 1240657 + hypothetical protein VNG1663C False
VNG1664H CDS 1448216 chromosome 1240710 1240901 + hypothetical protein VNG1664H False
VNG1898C CDS 1448392 chromosome 1404628 1405080 + hypothetical protein VNG1898C False
VNG1933G ftsZ3 CDS 1448420 chromosome 1424535 1425587 + cell division protein False
VNG2195G coxB2 CDS 1448629 chromosome 1626543 1626980 - cytochrome c oxidase subunit II False
VNG2196G hcpB CDS 1448630 chromosome 1627091 1627957 - halocyanin-like protein False
VNG2259C CDS 1448680 chromosome 1680625 1682103 + phosphoenolpyruvate carboxylase False
VNG2310H CDS 1448722 chromosome 1722306 1722596 + hypothetical protein VNG2310H False
VNG2311H CDS 1448723 chromosome 1722596 1723111 + hypothetical protein VNG2311H False
VNG2432C CDS 1448817 chromosome 1826736 1827050 - hypothetical protein VNG2432C False
VNG2499G gcdH CDS 1448863 chromosome 1866390 1867403 - glutaryl-CoA dehydrogenase False
VNG2508C CDS 1448869 chromosome 1874236 1874547 + hypothetical protein VNG2508C False
VNG2603H CDS 1448950 chromosome 1945888 1946232 - hypothetical protein VNG2603H False
VNG2604Gm THI1 CDS 1449073 chromosome 1946319 1947251 + ribulose-1,5-biphosphate synthetase False
VNG2606G thiD CDS 1448951 chromosome 1947251 1948588 + hypothetical protein VNG2606G False
VNG2644C CDS 1448983 chromosome 1980692 1981048 - hypothetical protein VNG2644C False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 25

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.