Organism : Halobacterium salinarum NRC-1 | Module List :
VNG0262C

hypothetical protein VNG0262C

CircVis
Functional Annotations (1)
Function System
Exopolyphosphatase-related proteins cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG0262C
(Mouseover regulator name to see its description)

VNG0262C is regulated by 52 influences and regulates 0 modules.
Regulators for VNG0262C (52)
Regulator Module Operator
VNG0040C
VNG0293H
113 combiner
VNG0194H 113 tf
VNG0258H 113 tf
VNG0703H
VNG2641H
113 combiner
VNG1836G 113 tf
VNG1836G
VNG2441G
113 combiner
VNG0040C
VNG0293H
79 combiner
VNG0293H
VNG0703H
79 combiner
VNG0703H
VNG2641H
79 combiner
VNG1029C
VNG2641H
79 combiner
VNG0040C
VNG0293H
109 combiner
VNG0254G 109 tf
VNG0734G
VNG0293H
109 combiner
VNG0734G
VNG0424C
109 combiner
VNG2243G
VNG0293H
109 combiner
VNG0194H 49 tf
VNG0254G 49 tf
VNG0293H
VNG0703H
49 combiner
VNG0734G
VNG2641H
49 combiner
VNG1029C 49 tf
VNG1123G 49 tf
VNG1464G
VNG1029C
49 combiner
VNG1496G
VNG0320H
49 combiner
VNG2163H 49 tf
VNG2243G 49 tf
VNG0458G
VNG2163H
50 combiner
VNG0458G
VNG2641H
50 combiner
VNG1029C
VNG2641H
50 combiner
VNG1836G
VNG0458G
50 combiner
VNG1899G
VNG0258H
50 combiner
VNG1899G
VNG2243G
50 combiner
VNG1899G
VNG2641H
50 combiner
VNG2243G
VNG0293H
50 combiner
VNG2243G
VNG0751C
50 combiner
VNG2441G
VNG0258H
50 combiner
VNG0040C
VNG0293H
55 combiner
VNG0258H
VNG0751C
55 combiner
VNG0734G
VNG2641H
55 combiner
VNG1029C
VNG2641H
55 combiner
VNG1899G
VNG0258H
55 combiner
VNG1899G
VNG0293H
55 combiner
VNG2243G
VNG0293H
55 combiner
VNG0194H 25 tf
VNG0458G
VNG2641H
25 combiner
VNG1899G
VNG2243G
25 combiner
VNG1899G
VNG2641H
25 combiner
VNG2243G
VNG0293H
25 combiner
VNG2441G
VNG2641H
25 combiner
VNG0040C
VNG0293H
12 combiner
VNG0293H
VNG0703H
12 combiner
VNG1029C
VNG2641H
12 combiner
VNG1496G
VNG0320H
12 combiner

Warning: VNG0262C Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 16 motifs predicted.

Motif Table (16)
Motif Id e-value Consensus Motif Logo
1003 8.00e-06 g.AAatctttaAgT
Loader icon
1004 1.00e-01 agaaAt.gg.TgT.cgtAT
Loader icon
1027 8.00e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1028 5.20e+02 GgGTtcCcGtcgGaGgCaAAaAC
Loader icon
1075 7.90e-01 aGAaAAttgtTga
Loader icon
1076 7.90e+00 gaAtcgaacggaAagcaTtaAgT
Loader icon
1077 1.60e-01 taa.ATaAatA
Loader icon
1078 3.00e+03 cttCGAGcacacgcAgGagca
Loader icon
1085 1.50e+03 gTCGTTCC
Loader icon
1086 2.60e+03 AagATaAAaAtG
Loader icon
1133 2.60e-04 Aaat.tgtttcatGtgAgaaaa
Loader icon
1134 3.30e+01 GCGatacgaaAaCc.tT.ttC
Loader icon
1191 8.10e-01 CaGgaaAgaaatGTtTaAaTG
Loader icon
1192 1.10e+01 GgcGCgcCCCACACCTcCaaC
Loader icon
1199 8.00e-06 tA.taAT.tgtgTtc
Loader icon
1200 4.30e+01 cAaTTtTgTat
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG0262C

VNG0262C is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Exopolyphosphatase-related proteins cog/ cog
Module neighborhood information for VNG0262C

VNG0262C has total of 92 gene neighbors in modules 12, 25, 49, 50, 55, 79, 109, 113
Gene neighbors (92)
Gene Common Name Description Module membership
VNG0162G alkK AlkK 3, 12, 49, 113, 123
VNG0192G ftsZ2 cell division protein FtsZ 2, 3, 7, 12, 16, 49, 50, 71, 78, 79, 123
VNG0194H hypothetical protein VNG0194H 3, 7, 12, 16, 50, 79, 123
VNG0207H hypothetical protein VNG0207H 2, 3, 7, 12, 16, 49, 67, 71, 78, 79, 113, 123
VNG0208H hypothetical protein VNG0208H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0209H hypothetical protein VNG0209H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0227H hypothetical protein VNG0227H 25, 55
VNG0254G tfbG transcription initiation factor IIB 3, 12, 25, 50, 55, 113
VNG0258H hypothetical protein VNG0258H 3, 12, 16, 49, 79, 100, 109, 150
VNG0259G ipp inorganic pyrophosphatase 7, 12, 16, 79, 109
VNG0261H hypothetical protein VNG0261H 7, 12, 16, 25, 49, 50, 55, 79, 109, 113
VNG0262C hypothetical protein VNG0262C 12, 25, 49, 50, 55, 79, 109, 113
VNG0264H hypothetical protein VNG0264H 55, 109
VNG0282H hypothetical protein VNG0282H 109
VNG0321G ids Ids 7, 25, 50, 55
VNG0524G yurY ABC transporter ATP-binding protein 2, 3, 7, 12, 16, 71, 113, 225
VNG0525C hypothetical protein VNG0525C 7, 12, 71, 78, 113, 225
VNG0527C hypothetical protein VNG0527C 2, 3, 7, 12, 16, 71, 78, 79, 113, 123, 225
VNG0533H hypothetical protein VNG0533H 25, 50
VNG0579H hypothetical protein VNG0579H 49, 79, 123, 187
VNG0586C hypothetical protein VNG0586C 79, 187
VNG0796G cgs cystathionine gamma synthase/lyase 7, 50
VNG0801C hypothetical protein VNG0801C 12, 49, 71, 79, 113, 187
VNG0880G psmA proteasome subunit alpha 12, 49, 71, 79, 109
VNG0906H hypothetical protein VNG0906H 71, 79
VNG0931G acaB2 3-ketoacyl-CoA thiolase 50, 283
VNG0932C hypothetical protein VNG0932C 25, 50, 61
VNG0940Gm ACS3 Acetyl-CoA synthetase 7, 19, 24, 25, 29, 49
VNG0955G fapE flagella-like protein E 7, 16, 25, 50, 100, 291
VNG0960G flaB1 flagellin B1 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123
VNG0961G flaB2 flagellin B2 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123, 291
VNG0962G flaB3 flagellin B3 2, 3, 7, 12, 16, 49, 78, 100, 113, 123
VNG0963G cpcE phycocyanin alpha phycocyanobilin lyase-like protein 12, 79
VNG0964C hypothetical protein VNG0964C 12, 24, 49, 100, 109
VNG0973G cheB hypothetical protein VNG0973G 55, 61, 184
VNG0974G cheY hypothetical protein VNG0974G 7, 55, 61, 184
VNG0976G cheW1 chemotaxis protein 7, 55
VNG0999H hypothetical protein VNG0999H 79, 187
VNG1002H hypothetical protein VNG1002H 49, 242
VNG1009G flaA2 flagellin A2 81, 113
VNG1093C hypothetical protein VNG1093C 71, 79, 187
VNG1125G korB KorB 7, 12, 24, 29
VNG1128G korA KorA 3, 7, 12, 24, 29, 49, 71, 78, 113
VNG1189H hypothetical protein VNG1189H 79, 187
VNG1261H hypothetical protein VNG1261H 49, 113
VNG1264C hypothetical protein VNG1264C 9, 25, 55, 84
VNG1273G moaC putative molybdenum cofactor biosynthesis protein MoaC 25, 81
VNG1306G sdhA hypothetical protein VNG1306G 2, 3, 12, 16, 78, 79, 90, 100
VNG1326H hypothetical protein VNG1326H 25, 50, 55
VNG1412H hypothetical protein VNG1412H 3, 12, 49, 71, 79, 113
VNG1446H hypothetical protein VNG1446H 25, 55
VNG1663C hypothetical protein VNG1663C 25, 50
VNG1664H hypothetical protein VNG1664H 25, 50
VNG1836G cspD2 cold shock protein 3, 12, 49, 71, 79
VNG1898C hypothetical protein VNG1898C 25, 50, 55
VNG1933G ftsZ3 cell division protein 7, 25, 61, 227
VNG2006C hypothetical protein VNG2006C 79, 113, 170, 187
VNG2008H hypothetical protein VNG2008H 9, 49, 79, 113, 170, 187
VNG2044H hypothetical protein VNG2044H 79, 187
VNG2081H hypothetical protein VNG2081H 49, 50, 123, 175, 187
VNG2104G pchB potassium channel-like protein 50, 275
VNG2122G ilvE2 branched-chain amino acid aminotransferase 7, 19, 29, 49, 71, 75, 78
VNG2193Gm coxA1 cytochrome c oxidase subunit I 50
VNG2195G coxB2 cytochrome c oxidase subunit II 25, 50
VNG2196G hcpB halocyanin-like protein 25, 50
VNG2226G cctA thermosome subunit alpha 3, 7, 12, 29, 49, 50, 52, 78, 113
VNG2251G achY S-adenosyl-L-homocysteine hydrolase 24, 29, 49, 71, 79, 113
VNG2259C phosphoenolpyruvate carboxylase 25, 50
VNG2293G fer2 ferredoxin 3, 110, 113
VNG2310H hypothetical protein VNG2310H 25, 229
VNG2311H hypothetical protein VNG2311H 25, 229
VNG2337C hypothetical protein VNG2337C 16, 29, 49, 113
VNG2377G nosY hypothetical protein VNG2377G 50, 90
VNG2412H hypothetical protein VNG2412H 113, 242
VNG2413H hypothetical protein VNG2413H 9, 84, 113, 242
VNG2432C hypothetical protein VNG2432C 25, 50
VNG2443G dpsA starvation induced DNA-binding protein 3, 12, 49, 71, 79, 113, 123, 187
VNG2499G gcdH glutaryl-CoA dehydrogenase 7, 24, 25, 50, 61, 78
VNG2508C hypothetical protein VNG2508C 25, 50, 55
VNG2543C hypothetical protein VNG2543C 3, 12, 49, 71, 78, 113, 156
VNG2603H hypothetical protein VNG2603H 25, 61
VNG2604Gm THI1 ribulose-1,5-biphosphate synthetase 25, 61
VNG2606G thiD hypothetical protein VNG2606G 25, 61
VNG2617G adh2 alcohol dehydrogenase 50
VNG2644C hypothetical protein VNG2644C 25, 50
VNG2649G eef1a elongation factor 1-alpha 2, 3, 16, 24, 29, 40, 79, 110
VNG5049H None 50
VNG6201G hsp5 heat shock protease protein 3, 49, 71, 79, 98, 100, 113, 187, 240
VNG6251H hypothetical protein VNG6251H 113, 242
VNG6313G nhaC3 Na+/H+ antiporter 2, 3, 12, 16, 50, 113
VNG7039 cydA cytochrome d ubiquinol oxidase subunit I 50
VNG7101 hypothetical protein VNG7101 49, 71, 113
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG0262C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend