Organism : Halobacterium salinarum NRC-1
| Module List :
VNG1933G ftsZ3
cell division protein
Functional Annotations (4)
| Function | System |
|---|---|
| Cell division GTPase | cog/ cog |
| GTP binding | go/ molecular_function |
| microtubule | go/ cellular_component |
| microtubule-based process | go/ biological_process |
Regulation information for VNG1933G
(Mouseover regulator name to see its description)
| Regulator | Module | Operator |
|---|---|---|
| VNG0254G | 7 | tf |
| VNG0536G VNG0258H |
7 | combiner |
| VNG1836G VNG1899G |
7 | combiner |
| VNG1899G VNG0258H |
7 | combiner |
| VNG5028G VNG0258H |
7 | combiner |
| VNG0101G VNG2441G |
61 | combiner |
| VNG1899G VNG1029C |
61 | combiner |
| VNG1899G VNG2243G |
61 | combiner |
| VNG1922G VNG1405C |
227 | combiner |
| VNG6193H | 227 | tf |
| VNG6389G | 227 | tf |
| VNG0194H | 25 | tf |
| VNG0458G VNG2641H |
25 | combiner |
| VNG1899G VNG2243G |
25 | combiner |
| VNG1899G VNG2641H |
25 | combiner |
| VNG2243G VNG0293H |
25 | combiner |
| VNG2441G VNG2641H |
25 | combiner |
Motif information (de novo identified motifs for modules)
There are 8 motifs predicted.
| Motif Id | e-value | Consensus | Motif Logo |
|---|---|---|---|
| 993 | 1.30e+01 | ttggtGataaTcgat |
![]() |
| 994 | 7.70e+02 | GAtAat..tCaactGTt.gtaA |
![]() |
| 1027 | 8.00e+00 | TACATGGTACAACTAGATAATTAA |
![]() |
| 1028 | 5.20e+02 | GgGTtcCcGtcgGaGgCaAAaAC |
![]() |
| 1097 | 1.30e-01 | gGcaCCCaAcACgct.a.ca |
![]() |
| 1098 | 3.60e+00 | TACATGGTACAACTAGATAATTAA |
![]() |
| 1395 | 5.80e+02 | CAtAATtGtTT |
![]() |
| 1396 | 4.10e+03 | AAaTcaAGTaGTTcTaTcTAA |
![]() |
Functional Enrichment for VNG1933G
| Function | System |
|---|---|
| Cell division GTPase | cog/ cog |
| GTP binding | go/ molecular_function |
| microtubule | go/ cellular_component |
| microtubule-based process | go/ biological_process |
Module neighborhood information for VNG1933G
| Gene | Common Name | Description | Module membership |
|---|---|---|---|
| VNG0192G | ftsZ2 | cell division protein FtsZ | 2, 3, 7, 12, 16, 49, 50, 71, 78, 79, 123 |
| VNG0194H | hypothetical protein VNG0194H | 3, 7, 12, 16, 50, 79, 123 | |
| VNG0207H | hypothetical protein VNG0207H | 2, 3, 7, 12, 16, 49, 67, 71, 78, 79, 113, 123 | |
| VNG0208H | hypothetical protein VNG0208H | 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123 | |
| VNG0209H | hypothetical protein VNG0209H | 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123 | |
| VNG0227H | hypothetical protein VNG0227H | 25, 55 | |
| VNG0254G | tfbG | transcription initiation factor IIB | 3, 12, 25, 50, 55, 113 |
| VNG0259G | ipp | inorganic pyrophosphatase | 7, 12, 16, 79, 109 |
| VNG0261H | hypothetical protein VNG0261H | 7, 12, 16, 25, 49, 50, 55, 79, 109, 113 | |
| VNG0262C | hypothetical protein VNG0262C | 12, 25, 49, 50, 55, 79, 109, 113 | |
| VNG0321G | ids | Ids | 7, 25, 50, 55 |
| VNG0524G | yurY | ABC transporter ATP-binding protein | 2, 3, 7, 12, 16, 71, 113, 225 |
| VNG0525C | hypothetical protein VNG0525C | 7, 12, 71, 78, 113, 225 | |
| VNG0527C | hypothetical protein VNG0527C | 2, 3, 7, 12, 16, 71, 78, 79, 113, 123, 225 | |
| VNG0533H | hypothetical protein VNG0533H | 25, 50 | |
| VNG0796G | cgs | cystathionine gamma synthase/lyase | 7, 50 |
| VNG0932C | hypothetical protein VNG0932C | 25, 50, 61 | |
| VNG0940Gm | ACS3 | Acetyl-CoA synthetase | 7, 19, 24, 25, 29, 49 |
| VNG0946G | minD1 | cell division inhibitor | 7 |
| VNG0949G | gspE3 | type II secretion system protein | 7 |
| VNG0954C | hypothetical protein VNG0954C | 7, 278, 283 | |
| VNG0955G | fapE | flagella-like protein E | 7, 16, 25, 50, 100, 291 |
| VNG0960G | flaB1 | flagellin B1 | 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123 |
| VNG0961G | flaB2 | flagellin B2 | 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123, 291 |
| VNG0962G | flaB3 | flagellin B3 | 2, 3, 7, 12, 16, 49, 78, 100, 113, 123 |
| VNG0967Gm | cheD | chemotaxis protein | 61, 184 |
| VNG0970G | cheC1 | chemotaxis protein | 61, 184 |
| VNG0971G | cheA | hypothetical protein VNG0971G | 61, 184 |
| VNG0973G | cheB | hypothetical protein VNG0973G | 55, 61, 184 |
| VNG0974G | cheY | hypothetical protein VNG0974G | 7, 55, 61, 184 |
| VNG0976G | cheW1 | chemotaxis protein | 7, 55 |
| VNG1125G | korB | KorB | 7, 12, 24, 29 |
| VNG1128G | korA | KorA | 3, 7, 12, 24, 29, 49, 71, 78, 113 |
| VNG1264C | hypothetical protein VNG1264C | 9, 25, 55, 84 | |
| VNG1273G | moaC | putative molybdenum cofactor biosynthesis protein MoaC | 25, 81 |
| VNG1326H | hypothetical protein VNG1326H | 25, 50, 55 | |
| VNG1408G | ush | UDP-sugar hydrolase | 61 |
| VNG1413H | hypothetical protein VNG1413H | 61 | |
| VNG1414G | glyA | serine hydroxymethyltransferase | 61 |
| VNG1446H | hypothetical protein VNG1446H | 25, 55 | |
| VNG1550G | cbiT | cobalamin biosynthesis protein | 45, 67, 114, 227 |
| VNG1551G | cbiL | cobalt-precorrin-2 C(20)-methyltransferase | 45, 67, 114, 124, 227 |
| VNG1553G | cbiF | cobalamin biosynthesis protein | 45, 114, 227 |
| VNG1554G | cbiG | cobalamin biosynthesis protein CbiG | 45, 61, 67, 114, 124, 227 |
| VNG1555G | cobH | hypothetical protein VNG1555G | 227 |
| VNG1557G | cbiH | cobalamin biosynthesis protein | 45, 61, 67, 114, 124, 174, 227 |
| VNG1558H | hypothetical protein VNG1558H | 45, 61, 67, 114, 124, 174, 227 | |
| VNG1559H | hypothetical protein VNG1559H | 45, 114, 124, 174, 227 | |
| VNG1561Cm | ferredoxin | 227 | |
| VNG1562H | hypothetical protein VNG1562H | 45, 114, 124, 174, 205, 227 | |
| VNG1564H | hypothetical protein VNG1564H | 114, 124, 174, 205, 226, 227 | |
| VNG1566G | cobN | hypothetical protein VNG1566G | 61, 124 |
| VNG1567G | cbiC | precorrin isomerase | 61, 114, 124 |
| VNG1568G | cbiJ | cobalt-precorrin-6Y C(5)-methyltransferase | 61, 114, 124 |
| VNG1632G | cbiQ | hypothetical protein VNG1632G | 76, 114, 163, 174, 205, 226, 227 |
| VNG1635G | cbiM | cobalt transport protein CbiM | 76, 163, 205, 226, 227 |
| VNG1663C | hypothetical protein VNG1663C | 25, 50 | |
| VNG1664H | hypothetical protein VNG1664H | 25, 50 | |
| VNG1699C | ribonuclease P protein component 1 | 1, 10, 23, 39, 99, 180, 227 | |
| VNG1898C | hypothetical protein VNG1898C | 25, 50, 55 | |
| VNG1933G | ftsZ3 | cell division protein | 7, 25, 61, 227 |
| VNG1934H | hypothetical protein VNG1934H | 227 | |
| VNG2122G | ilvE2 | branched-chain amino acid aminotransferase | 7, 19, 29, 49, 71, 75, 78 |
| VNG2138G | atpB | V-type ATP synthase subunit B | 45, 67, 114, 124, 227 |
| VNG2139G | atpA | V-type ATP synthase subunit A | 23, 24, 33, 39, 45, 67, 114, 124, 227 |
| VNG2140G | atpF | V-type ATP synthase subunit F | 33, 39, 45, 67, 114, 124, 227 |
| VNG2141G | atpC | V-type ATP synthase subunit C | 23, 39, 45, 67, 114, 124, 227 |
| VNG2142G | atpE | V-type ATP synthase subunit E | 19, 24, 45, 67, 114, 227 |
| VNG2143G | atpK | H+-transporting ATP synthase subunit K | 2, 19, 23, 24, 45, 67, 75, 114, 124, 227 |
| VNG2144G | atpI | H+-transporting ATP synthase subunit I | 19, 23, 24, 45, 67, 75, 124, 227 |
| VNG2146H | hypothetical protein VNG2146H | 2, 16, 19, 24, 45, 67, 124, 227 | |
| VNG2151G | etfA | electron transfer flavoprotein subunit alpha | 33, 45, 61, 124 |
| VNG2195G | coxB2 | cytochrome c oxidase subunit II | 25, 50 |
| VNG2196G | hcpB | halocyanin-like protein | 25, 50 |
| VNG2217G | pdhA2 | pyruvate dehydrogenase alpha subunit | 45, 61, 124 |
| VNG2218G | pdhB | hypothetical protein VNG2218G | 45, 61, 124, 174 |
| VNG2219G | dsa | branched-chain alpha-keto acid dehydrogenase subunit E2 | 45, 61, 124, 174 |
| VNG2220G | lpdA | LpdA | 45, 61, 124, 174, 184 |
| VNG2226G | cctA | thermosome subunit alpha | 3, 7, 12, 29, 49, 50, 52, 78, 113 |
| VNG2259C | phosphoenolpyruvate carboxylase | 25, 50 | |
| VNG2310H | hypothetical protein VNG2310H | 25, 229 | |
| VNG2311H | hypothetical protein VNG2311H | 25, 229 | |
| VNG2349G | dppA | hypothetical protein VNG2349G | 61 |
| VNG2400H | hypothetical protein VNG2400H | 61, 184 | |
| VNG2430G | thrC1 | threonine synthase | 61, 77 |
| VNG2432C | hypothetical protein VNG2432C | 25, 50 | |
| VNG2499G | gcdH | glutaryl-CoA dehydrogenase | 7, 24, 25, 50, 61, 78 |
| VNG2508C | hypothetical protein VNG2508C | 25, 50, 55 | |
| VNG2539H | hypothetical protein VNG2539H | 7, 29, 78 | |
| VNG2603H | hypothetical protein VNG2603H | 25, 61 | |
| VNG2604Gm | THI1 | ribulose-1,5-biphosphate synthetase | 25, 61 |
| VNG2606G | thiD | hypothetical protein VNG2606G | 25, 61 |
| VNG2644C | hypothetical protein VNG2644C | 25, 50 | |
| VNG7015 | gvpM | gas vesicle protein GvpM | 227 |
| VNG7017 | gvpK | gas vesicle protein GvpK | 227 |
| VNG7018 | gvpJ | gas vesicle protein GvpJ | 227 |
| VNG7021 | gvpG | gas vesicle protein GvpG | 227 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend


Module member
Regulator
Motif 

Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.