Organism : Pseudomonas aeruginosa | Module List :
PA3269

probable transcriptional regulator (NCBI)

CircVis
Functional Annotations (6)
Function System
AraC-type DNA-binding domain-containing proteins cog/ cog
DNA binding go/ molecular_function
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
sequence-specific DNA binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for PA3269
(Mouseover regulator name to see its description)

PA3269 is regulated by 19 influences and regulates 8 modules.
Regulators for PA3269 (19)
Regulator Module Operator
PA0218 187 tf
PA0828 187 tf
PA1403 187 tf
PA1850 187 tf
PA2115 187 tf
PA2758 187 tf
PA3269 187 tf
PA3565 187 tf
PA3594 187 tf
PA3898 187 tf
PA0961 103 tf
PA3269 103 tf
PA3604 103 tf
PA4057 103 tf
PA4275 103 tf
PA4451 103 tf
PA4745 103 tf
PA5239 103 tf
PA5550 103 tf

Warning: PA3269 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
3038 2.00e+02 AAACGGAGGCATTGGGTAGATAAT
Loader icon
3039 2.50e+02 GtCG.CGaagAAc.C.atcgGC
Loader icon
3202 6.40e+02 TCgagC.cctcg.ccagGcccTc
Loader icon
3203 1.90e+02 g.CggCagCgcCcGcgCgacg
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for PA3269

PA3269 is enriched for 6 functions in 3 categories.
Enrichment Table (6)
Function System
AraC-type DNA-binding domain-containing proteins cog/ cog
DNA binding go/ molecular_function
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
sequence-specific DNA binding go/ molecular_function
Module neighborhood information for PA3269

PA3269 has total of 51 gene neighbors in modules 103, 187
Gene neighbors (51)
Gene Common Name Description Module membership
PA0048 PA0048 probable transcriptional regulator (NCBI) 62, 187
PA0331 ilvA1 threonine dehydratase, biosynthetic (NCBI) 103, 312
PA0433 PA0433 hypothetical protein (NCBI) 187, 220
PA0733 PA0733 probable pseudouridylate synthase (NCBI) 103, 451
PA0734 PA0734 hypothetical protein (NCBI) 103, 451
PA0801 PA0801 hypothetical protein (NCBI) 99, 187
PA0849 trxB2 thioredoxin reductase 2 (NCBI) 152, 187
PA0932 cysM cysteine synthase B (NCBI) 103, 195
PA1139 PA1139 hypothetical protein (NCBI) 187, 229
PA1140 PA1140 hypothetical protein (NCBI) 26, 187
PA1331 PA1331 hypothetical protein (NCBI) 187, 226
PA1403 PA1403 probable transcriptional regulator (NCBI) 187, 283
PA1472 PA1472 hypothetical protein (NCBI) 187, 372
PA1870 PA1870 hypothetical protein (NCBI) 187, 521
PA1966 PA1966 hypothetical protein (NCBI) 187, 372
PA2115 PA2115 probable transcriptional regulator (NCBI) 187, 283
PA2170 PA2170 hypothetical protein (NCBI) 187, 521
PA2184 PA2184 hypothetical protein (NCBI) 187, 521
PA2650 PA2650 hypothetical protein (NCBI) 187, 197
PA2694 PA2694 probable thioredoxin (NCBI) 187, 355
PA2865 PA2865 probable glycosylase (NCBI) 103, 181
PA2866 mttC secretion protein MttC (NCBI) 86, 103
PA2955 PA2955 hypothetical protein (NCBI) 103, 371
PA2988 PA2988 hypothetical protein (NCBI) 103, 306
PA3030 mobA molybdopterin-guanine dinucleotide biosynthesis protein A (NCBI) 9, 187
PA3196 PA3196 hypothetical protein (NCBI) 187, 493
PA3269 PA3269 probable transcriptional regulator (NCBI) 103, 187
PA3271 PA3271 probable two-component sensor (NCBI) 39, 187
PA3436 PA3436 hypothetical protein (NCBI) 187, 326
PA3737 dsbC thiol:disulfide interchange protein DsbC (NCBI) 103, 251
PA3883 PA3883 short chain dehydrogenase (NCBI) 53, 187
PA3886 PA3886 hypothetical protein (NCBI) 187, 241
PA3898 PA3898 probable transcriptional regulator (NCBI) 58, 187
PA3957 PA3957 short chain dehydrogenase (NCBI) 159, 187
PA4001 sltB1 soluble lytic transglycosylase B (NCBI) 103, 341
PA4183 PA4183 hypothetical protein (NCBI) 187, 320
PA4290 PA4290 probable chemotaxis transducer (NCBI) 187, 226
PA4291 PA4291 hypothetical protein (NCBI) 100, 103
PA4361 PA4361 probable oxidoreductase (NCBI) 187, 394
PA4626 hprA glycerate dehydrogenase (NCBI) 170, 187
PA4631 PA4631 hypothetical protein (NCBI) 138, 187
PA4678 rimI peptide n-acetyltransferase RimI (NCBI) 103, 387
PA4679 PA4679 hypothetical protein (NCBI) 103, 374
PA4700 mrcB penicillin-binding protein 1B (NCBI) 103, 249
PA4997 msbA transport protein MsbA (NCBI) 103, 451
PA5073 PA5073 hypothetical protein (NCBI) 187, 251
PA5123 PA5123 hypothetical protein (NCBI) 187, 320
PA5133 PA5133 hypothetical protein (NCBI) 103, 306
PA5244 PA5244 hypothetical protein (NCBI) 103, 306
PA5314 PA5314 hypothetical protein (NCBI) 187, 338
PA5533 PA5533 hypothetical protein (NCBI) 9, 187
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for PA3269
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend