Organism : Bacillus cereus ATCC14579 | Module List :
BC3084

Transcriptional regulator, TetR family (NCBI ptt file)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulator cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
regulation of transcription, DNA-dependent go/ biological_process
specific transcriptional repressor activity go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BC3084
(Mouseover regulator name to see its description)

BC3084 is regulated by 26 influences and regulates 12 modules.
Regulators for BC3084 (26)
Regulator Module Operator
BC0230 399 tf
BC0607 399 tf
BC1363 399 tf
BC2218 399 tf
BC2672 399 tf
BC3084 399 tf
BC3332 399 tf
BC3792 399 tf
BC3814 399 tf
BC3826 399 tf
BC3868 399 tf
BC4356 399 tf
BC4525 399 tf
BC4842 399 tf
BC5024 399 tf
BC1363 249 tf
BC1987 249 tf
BC2401 249 tf
BC2770 249 tf
BC3084 249 tf
BC3982 249 tf
BC4010 249 tf
BC4057 249 tf
BC4525 249 tf
BC5173 249 tf
BC5339 249 tf
Regulated by BC3084 (12)
Module Residual Genes
25 0.54 37
45 0.36 16
102 0.46 16
138 0.50 14
139 0.49 32
232 0.53 12
249 0.43 16
307 0.41 16
399 0.45 21
402 0.61 14
465 0.52 19
515 0.37 19
Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4414 1.80e-01 CcctTCtTgTtTaC
Loader icon
4415 1.10e+02 GGTTGGGGAGGTTACCAACC
Loader icon
4708 2.80e+04 CcCGTTCTAatGCc
Loader icon
4709 5.00e+02 tAaggagGaa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BC3084

BC3084 is enriched for 5 functions in 3 categories.
Module neighborhood information for BC3084

BC3084 has total of 36 gene neighbors in modules 249, 399
Gene neighbors (36)
Gene Common Name Description Module membership
BC0190 BC0190 Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (NCBI ptt file) 134, 399
BC0365 BC0365 Nitrogen regulation protein NIFR3 (NCBI ptt file) 399, 432
BC0372 BC0372 hypothetical protein (NCBI ptt file) 249, 453
BC0813 BC0813 enterotoxin / cell-wall binding protein (NCBI ptt file) 399, 482
BC0892 BC0892 hypothetical protein (NCBI ptt file) 399, 477
BC0903 BC0903 Methyltransferase (NCBI ptt file) 55, 249
BC0927 BC0927 hypothetical protein (NCBI ptt file) 55, 249
BC1231 BC1231 Sodium/proline symporter (NCBI ptt file) 139, 399
BC1986 BC1986 Transporter, LysE family (NCBI ptt file) 249, 465
BC1987 BC1987 Transcriptional regulator, GntR family (NCBI ptt file) 249, 465
BC1988 BC1988 hypothetical protein (NCBI ptt file) 249, 465
BC1990 BC1990 hypothetical Cytosolic Protein (NCBI ptt file) 6, 249
BC2234 BC2234 Arginine/ornithine antiporter (NCBI ptt file) 159, 399
BC2270 BC2270 hypothetical protein (NCBI ptt file) 249, 465
BC2818 BC2818 hypothetical Cytosolic Protein (NCBI ptt file) 148, 249
BC2887 BC2887 hypothetical Cytosolic Protein (NCBI ptt file) 399, 465
BC2929 BC2929 Peptidoglycan N-acetylglucosamine deacetylase (NCBI ptt file) 382, 399
BC2977 BC2977 Pyrroline-5-carboxylate reductase (NCBI ptt file) 148, 249
BC3084 BC3084 Transcriptional regulator, TetR family (NCBI ptt file) 249, 399
BC3094 BC3094 L-asparaginase (NCBI ptt file) 161, 399
BC3456 BC3456 Bicyclomycin resistance protein (NCBI ptt file) 249, 465
BC3772 BC3772 tRNA 2-methylthioadenosine synthase (NCBI ptt file) 243, 399
BC3831 BC3831 DNA topoisomerase I (NCBI ptt file) 192, 399
BC3981 BC3981 Tetrahydrodipicolinate N-acetyltransferase (NCBI ptt file) 103, 399
BC4021 BC4021 hypothetical protein (NCBI ptt file) 55, 249
BC4022 BC4022 ABC transporter ATP-binding protein (NCBI ptt file) 55, 249
BC4300 BC4300 hypothetical Metal-Binding Protein (NCBI ptt file) 27, 399
BC4301 BC4301 Metal-dependent phosphohydrolase (NCBI ptt file) 27, 399
BC4653 BC4653 GAF domain-containing proteins (NCBI ptt file) 399, 505
BC4706 BC4706 NAD(FAD)-utilizing dehydrogenases (NCBI ptt file) 399, 433
BC4722 BC4722 Molybdenum cofactor biosynthesis protein C (NCBI ptt file) 74, 399
BC5064 BC5064 hypothetical protein (NCBI ptt file) 37, 249
BC5185 BC5185 Cell division protein ftsX (NCBI ptt file) 37, 399
BC5239 BC5239 enterotoxin / cell-wall binding protein (NCBI ptt file) 399, 465
BC5337 BC5337 hypothetical protein (NCBI ptt file) 148, 249
BC5371 BC5371 Spermidine synthase (NCBI ptt file) 399, 479
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BC3084
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend