Organism : Clostridium acetobutylicum | Module List :
CAC3456

Uncharacterized conserved protein, bioY family (NCBI ptt file)

CircVis
Functional Annotations (2)
Function System
Uncharacterized conserved protein cog/ cog
biotin synthase activity go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC3456
(Mouseover regulator name to see its description)

CAC3456 is regulated by 21 influences and regulates 0 modules.
Regulators for CAC3456 (21)
Regulator Module Operator
CAC0231 280 tf
CAC0289 280 tf
CAC1032 280 tf
CAC1455 280 tf
CAC1467 280 tf
CAC1695 280 tf
CAC1843 280 tf
CAC2306 280 tf
CAC2307 280 tf
CAC3200 280 tf
CAC3649 280 tf
CAC0231 199 tf
CAC1695 199 tf
CAC1786 199 tf
CAC1843 199 tf
CAC1869 199 tf
CAC2306 199 tf
CAC2859 199 tf
CAC2955 199 tf
CAC3370 199 tf
CAC3494 199 tf

Warning: CAC3456 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7050 1.40e-06 GGgGGA.G.
Loader icon
7051 4.10e+03 cCCCTTaTaGC
Loader icon
7212 1.00e-01 AGGgGt
Loader icon
7213 2.20e+01 CACATGTGTTTCGTTTGCGC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC3456

CAC3456 is enriched for 2 functions in 3 categories.
Enrichment Table (2)
Function System
Uncharacterized conserved protein cog/ cog
biotin synthase activity go/ molecular_function
Module neighborhood information for CAC3456

CAC3456 has total of 19 gene neighbors in modules 199, 280
Gene neighbors (19)
Gene Common Name Description Module membership
CAC0210 bioB Biotine synthase (gene bioB) (NCBI ptt file) 199, 280
CAC0211 bioY BioY protein precursor (NCBI ptt file) 199, 366
CAC0975 CAC0975 Predicted P-loop kinase or ATPase distantly related to phosphoenolpyruvate carboxykinase (NCBI ptt file) 199, 321
CAC1023 nadC Nicotinate-nucleotide pyrophosphorylase (NCBI ptt file) 277, 280
CAC1024 nadB Aspartate oxidase (NCBI ptt file) 184, 280
CAC1025 nadA Quinolinate synthase (NCBI ptt file) 184, 280
CAC1360 bioY Uncharacterized protein of BioY family (NCBI ptt file) 199, 280
CAC1361 bioD Dethiobiotin synthetase (NCBI ptt file) 199, 280
CAC1362 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotranferase (NCBI ptt file) 199, 280
CAC1363 sodC Superoxide dismutase, Cu-Zn family (NCBI ptt file) 199, 280
CAC1694 CAC1694 Sigma factor E processing enzyme, SpoIIGA (NCBI ptt file) 42, 199
CAC1695 sigE DNA-dependent RNA polymerase sigma subunit (NCBI ptt file) 199, 318
CAC1842 CAC1842 Uncharacterized protein, B.subtilis YTKC ortholog, related to regulatory protein UTXA (NCBI ptt file) 280, 366
CAC1843 CAC1843 Predicted transcriptional regulator, YDCN B.subtilis ortholog (NCBI ptt file) 235, 280
CAC1869 CAC1869 Predicted transcriptional regulator (NCBI ptt file) 199, 248
CAC2240 CAC2240 Protein shares with cyclomaltodextrin glucanotransferase C-terminal domain (NCBI ptt file) 184, 199
CAC3273 CAC3273 Possible surface protein, responsible for cell interaction; contains cell adhesion domain and ChW-repeats (NCBI ptt file) 235, 280
CAC3455 CAC3455 Uncharacterized conserved predicted metal-binding protein (NCBI ptt file) 199, 280
CAC3456 CAC3456 Uncharacterized conserved protein, bioY family (NCBI ptt file) 199, 280
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC3456
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend