Organism : Campylobacter jejuni | Module List :
Cj1613c

hypothetical protein Cj1613c (NCBI ptt file)

CircVis
Functional Annotations (2)
Function System
Putative heme iron utilization protein cog/ cog
FMN binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Cj1613c
(Mouseover regulator name to see its description)

Cj1613c is regulated by 5 influences and regulates 0 modules.
Regulators for Cj1613c (5)
Regulator Module Operator
Cj0322 16 tf
Cj0757 16 tf
Cj0322 2 tf
Cj0460 2 tf
Cj0757 2 tf

Warning: Cj1613c Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7386 1.30e+03 cCCcTaCTCC
Loader icon
7387 6.70e+03 CTAGATTAAGTTAATAAAGG
Loader icon
7414 8.10e-02 CagtTggtc.agcGgc
Loader icon
7415 2.00e+01 CCAACACGGGACACC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Cj1613c

Cj1613c is enriched for 2 functions in 3 categories.
Enrichment Table (2)
Function System
Putative heme iron utilization protein cog/ cog
FMN binding go/ molecular_function
Module neighborhood information for Cj1613c

Cj1613c has total of 31 gene neighbors in modules 2, 16
Gene neighbors (31)
Gene Common Name Description Module membership
Cj0146c trxB thioredoxin reductase (NCBI ptt file) 16, 85
Cj0175c Cj0175c putative iron-uptake ABC transport system periplasmic iron-binding protein (NCBI ptt file) 16, 85
Cj0176c Cj0176c putative lipoprotein (NCBI ptt file) 16, 85
Cj0334 ahpC alkyl hydroperoxide reductase (NCBI ptt file) 16, 128
Cj0414 Cj0414 putative oxidoreductase subunit (NCBI ptt file) 2, 115
Cj0415 Cj0415 putative oxidoreductase subunit (NCBI ptt file) 2, 73
Cj0416 Cj0416 hypothetical protein Cj0416 (NCBI ptt file) 2, 156
Cj0417 Cj0417 hypothetical protein Cj0417 (NCBI ptt file) 2, 162
Cj0755 cfrA putative iron uptake protein (NCBI ptt file) 2, 16
Cj1383c Cj1383c hypothetical protein Cj1383c (NCBI ptt file) 16, 85
Cj1384c Cj1384c hypothetical protein Cj1384c (NCBI ptt file) 16, 85
Cj1385 katA catalase (NCBI ptt file) 16, 128
Cj1386 Cj1386 ankyrin-repeat containing protein (NCBI ptt file) 2, 40
Cj1392 metC' putative cystathionine beta-lyase, N-terminus (RefSeq) 16, 47
Cj1613c Cj1613c hypothetical protein Cj1613c (NCBI ptt file) 2, 16
Cj1614 chuA haemin uptake system outer membrane receptor (NCBI ptt file) 2, 107
Cj1615 chuB putative haemin uptake system permease protein (NCBI ptt file) 2, 115
Cj1616 chuC putative haemin uptake system ATP-binding protein (NCBI ptt file) 2, 104
Cj1617 chuD putative haemin uptake system periplasmic haemin-binding protein (NCBI ptt file) 2, 147
Cjp03 tRNA-Glu tRNA-Glu (NCBI) 2, 16
Cjp14 tRNA-Ala tRNA-Ala (NCBI) 16, 100
Cjp19 tRNA-Val tRNA-Val (NCBI) 16, 22
Cjp20 tRNA-Lys tRNA-Lys (NCBI) 4, 16
Cjp25 tRNA-Ser tRNA-Ser (NCBI) 2, 16
Cjr09 Cjr09 5S ribosomal RNA (NCBI) 2, 16
Cjt06 tRNA-Ser tRNA-Ser (NCBI) 16, 22
Cjt2 tRNA-Asp tRNA-Asp (NCBI) 2, 16
VIMSS46110 VIMSS46110 None 2, 22
VIMSS46541 VIMSS46541 None 2, 22
VIMSS46848 VIMSS46848 None 2, 150
VIMSS47021 VIMSS47021 None 2, 73
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Cj1613c
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend