Organism : Campylobacter jejuni | Module List:
Module 17 Profile

GeneModule member RegulatorRegulator MotifMotif
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 17

There are 5 regulatory influences for Module 17

Regulator Table (5)
Regulator Name Type
Cj0670 tf
Cj0466 tf
Cj0123c tf
Cj1273c tf
Cj0480c tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
7416 9.90e+01 AgCctaAg.ca
Loader icon
7417 3.40e+03 CTGTCTTCATAGTATAAAACCG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 17 is enriched for following functions.

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Cellular processes and signaling cog category 1.63e-02 2.76e-02 9/26
Signal transduction mechanisms cog subcategory 3.60e-04 7.28e-04 4/26
Posttranslational modification, protein turnover, chaperones cog subcategory 1.54e-02 2.61e-02 3/26
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 17

There are 26 genes in Module 17

Gene Member Table (26)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
Cj0123c Cj0123c DUMMY None chromosome 0 0 + putative transcriptional regulator (NCBI ptt file) True
Cj0125c Cj0125c DUMMY None chromosome 0 0 + dksA-like protein (NCBI ptt file) False
Cj0126c Cj0126c DUMMY None chromosome 0 0 + hypothetical protein Cj0126c (NCBI ptt file) False
Cj0166 miaA CDS None chromosome 164162 165031 + tRNA delta(2)-isopentenylpyrophosphate transferase (NCBI ptt file) False
Cj0293 surE CDS None chromosome 269064 269840 + SurE protein homolog (NCBI ptt file) False
Cj0363c Cj0363c DUMMY None chromosome 0 0 + putative oxidoreductase (NCBI ptt file) False
Cj0376 Cj0376 DUMMY None chromosome 0 0 + putative periplasmic protein (NCBI ptt file) False
Cj0466 Cj0466 DUMMY None chromosome 0 0 + putative transcriptional regulator (NCBI ptt file) True
Cj0650 Cj0650 DUMMY None chromosome 0 0 + putative ATP /GTP binding protein (NCBI ptt file) False
Cj0679 kdpD' CDS None chromosome 631667 633487 + truncated KdpD protein (NCBI ptt file) False
Cj0856 lepP CDS None chromosome 802203 803051 + signal peptidase I (NCBI ptt file) False
Cj0862c pabB CDS None chromosome 807497 809281 - para-aminobenzoate synthase component I (NCBI ptt file) False
Cj0943 Cj0943 DUMMY None chromosome 0 0 + putative periplasmic protein (NCBI ptt file) False
Cj1078 Cj1078 DUMMY None chromosome 0 0 + putative periplasmic protein (NCBI ptt file) False
Cj1108 clpA CDS None chromosome 1040450 1042579 + ATP-dependent CLP protease ATP-binding subunit (NCBI ptt file) False
Cj1116c ftsH CDS None chromosome 1047823 1049760 - membrane bound zinc metallopeptidase (NCBI ptt file) False
Cj1226c Cj1226c DUMMY None chromosome 0 0 + putative two-component sensor (NCBI ptt file) False
Cj1229 cbpA CDS None chromosome 1157879 1158772 + putative curved-DNA binding protein (NCBI ptt file) False
Cj1231 kefB CDS None chromosome 1159168 1160793 + putative glutathione-regulated potassium-efflux system protein (NCBI ptt file) False
Cj1233 Cj1233 DUMMY None chromosome 0 0 + putative hydrolase (NCBI ptt file) False
Cj1247c Cj1247c DUMMY None chromosome 0 0 + hypothetical protein Cj1247c (NCBI ptt file) False
Cj1334 Cj1334 DUMMY None chromosome 0 0 + hypothetical prootein Cj1334 (1318 family) (NCBI ptt file) False
Cj1378 selA CDS None chromosome 1316388 1317710 + L-seryl-tRNA(SeC) selenium transferase (NCBI ptt file) False
Cj1426c Cj1426c DUMMY None chromosome 0 0 + hypothetical protein Cj1426c (NCBI ptt file) False
Cj1684c Cj1684c DUMMY None chromosome 0 0 + putative transmembrane transport protein (NCBI ptt file) False
Cj1716c leuD CDS None chromosome 1627317 1627919 - putative 3-isopropylmalate dehydratase small subunit (NCBI ptt file) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.