Organism : Halobacterium salinarum NRC-1 | Module List :
VNG0065G gmd

GDP-D-mannose dehydratase

CircVis
Functional Annotations (10)
Function System
Nucleoside-diphosphate-sugar epimerases cog/ cog
UDP-glucose 4-epimerase activity go/ molecular_function
carbohydrate metabolic process go/ biological_process
biosynthetic process go/ biological_process
oxidoreductase activity go/ molecular_function
cellular metabolic process go/ biological_process
coenzyme binding go/ molecular_function
Galactose metabolism kegg/ kegg pathway
Amino sugar and nucleotide sugar metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG0065G
(Mouseover regulator name to see its description)

VNG0065G is regulated by 14 influences and regulates 0 modules.
Regulators for VNG0065G gmd (14)
Regulator Module Operator
VNG0247C 254 tf
VNG1179C 254 tf
VNG1510C 254 tf
VNG1786H 254 tf
VNG6143H 254 tf
VNG1237C 164 tf
VNG1383G 164 tf
VNG2579G
VNG0389C
164 combiner
VNG6143H 164 tf
VNG0247C 280 tf
VNG1510C 280 tf
VNG1548C 280 tf
VNG2579G 280 tf
VNG5068G
VNG1886C
280 combiner

Warning: VNG0065G Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 6 motifs predicted.

Motif Table (6)
Motif Id e-value Consensus Motif Logo
1289 4.40e-02 CgtGgcgGTTCtta.cAACGcGAA
Loader icon
1290 5.20e+01 TAATGGGCCTGGATGCAGTCACTA
Loader icon
1441 3.00e+03 aaTcactGaaaAC
Loader icon
1442 1.10e+04 GAGgAacCgaA
Loader icon
1489 1.40e+01 CcgGTTC.cg.tGgT
Loader icon
1490 3.40e+01 TAATGGGCCTGGATGCAGTCACTA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG0065G

VNG0065G is enriched for 10 functions in 3 categories.
Enrichment Table (10)
Function System
Nucleoside-diphosphate-sugar epimerases cog/ cog
UDP-glucose 4-epimerase activity go/ molecular_function
carbohydrate metabolic process go/ biological_process
biosynthetic process go/ biological_process
oxidoreductase activity go/ molecular_function
cellular metabolic process go/ biological_process
coenzyme binding go/ molecular_function
Galactose metabolism kegg/ kegg pathway
Amino sugar and nucleotide sugar metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Module neighborhood information for VNG0065G

VNG0065G has total of 37 gene neighbors in modules 164, 254, 280
Gene neighbors (37)
Gene Common Name Description Module membership
VNG0014C hypothetical protein VNG0014C 254, 264
VNG0022H hypothetical protein VNG0022H 30, 254
VNG0023H hypothetical protein VNG0023H 30, 254, 290
VNG0024H hypothetical protein VNG0024H 111, 254
VNG0057H hypothetical protein VNG0057H 26, 254
VNG0058H hypothetical protein VNG0058H 254, 270
VNG0062G lpb LPS biosynthesis protein 106, 164
VNG0063G galE2 UDP-glucose 4-epimerase 164, 280, 282
VNG0064G graD3 glucose-1-phosphate thymidylyltransferase 74, 164, 280, 293
VNG0065G gmd GDP-D-mannose dehydratase 164, 254, 280
VNG0068H hypothetical protein VNG0068H 254, 267
VNG0073C hypothetical protein VNG0073C 97, 254
VNG0076H hypothetical protein VNG0076H 28, 254
VNG0080H hypothetical protein VNG0080H 143, 254
VNG0085G moaA hypothetical protein VNG0085G 254, 267
VNG0086Gm moeA2 putative molybdopterin biosynthesis protein MoeA/LysR substrate binding-domain-containing protein 254, 264
VNG0091C hypothetical protein VNG0091C 254
VNG0108G rmeR RmeR 116, 247, 254
VNG0113H hypothetical protein VNG0113H 111, 254
VNG0123G trp1 ABC transport protein 254, 270
VNG0124C hypothetical protein VNG0124C 254, 270
VNG0142C hypothetical protein VNG0142C 254, 267
VNG0277G crtI3 phytoene dehydrogenase 254, 268
VNG0281G soxB sarcosine oxidase 254
VNG0297H hypothetical protein VNG0297H 254, 270
VNG0700G yvgX molybdenum-binding protein 254
VNG0731H hypothetical protein VNG0731H 43, 53, 164
VNG0752G galE1 UDP-glucose 4-epimerase 254
VNG0985H hypothetical protein VNG0985H 4, 5, 164
VNG1073G lfl1 Lfl1 254
VNG1112H hypothetical protein VNG1112H 173, 179, 280
VNG1176G fib fibrillarin 254
VNG1209G hutG formiminoglutamate hydrolase 254, 284
VNG1211G hutI imidazolonepropionase 254, 284
VNG2003G truA tRNA pseudouridine synthase A 118, 280
VNG2059H hypothetical protein VNG2059H 254
VNG2097C hypothetical protein VNG2097C 254
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG0065G
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend