Organism : Pseudomonas aeruginosa | Module List :
PA4495

hypothetical protein (NCBI)

CircVis
Functional Annotations (1)
Function System
Predicted periplasmic/secreted protein cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for PA4495
(Mouseover regulator name to see its description)

PA4495 is regulated by 28 influences and regulates 0 modules.
Regulators for PA4495 (28)
Regulator Module Operator
PA0376 551 tf
PA0762 551 tf
PA0763 551 tf
PA0765 551 tf
PA0784 551 tf
PA1097 551 tf
PA1520 551 tf
PA2016 551 tf
PA2047 551 tf
PA2577 551 tf
PA2586 551 tf
PA2622 551 tf
PA2737 551 tf
PA4315 551 tf
PA4493 551 tf
PA5253 551 tf
PA5483 551 tf
PA0179 525 tf
PA0376 525 tf
PA0763 525 tf
PA0905 525 tf
PA1142 525 tf
PA1754 525 tf
PA2622 525 tf
PA4315 525 tf
PA4764 525 tf
PA5253 525 tf
PA5288 525 tf

Warning: PA4495 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
3864 3.10e-05 tgCaaa.ggtTgctacgAa.aAtt
Loader icon
3865 1.00e+03 AATACCCCTACAGGGTATCA
Loader icon
3914 2.00e+00 tTgttagaa.ggacaatTct
Loader icon
3915 1.50e+03 GAAtTcagAcTgaa.AaaT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for PA4495

PA4495 is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Predicted periplasmic/secreted protein cog/ cog
Module neighborhood information for PA4495

PA4495 has total of 37 gene neighbors in modules 525, 551
Gene neighbors (37)
Gene Common Name Description Module membership
PA0039 PA0039 hypothetical protein (NCBI) 279, 525
PA0309 PA0309 hypothetical protein (NCBI) 221, 551
PA0655 PA0655 hypothetical protein (NCBI) 452, 551
PA0764 mucB negative regulator for alginate biosynthesis MucB (NCBI) 273, 551
PA0765 mucC positive regulator for alginate biosynthesis MucC (NCBI) 273, 551
PA0766 mucD serine protease MucD precursor (NCBI) 273, 551
PA0784 PA0784 probable transcriptional regulator (NCBI) 523, 551
PA0905 rsmA RsmA, regulator of secondary metabolites (NCBI) 57, 525
PA1097 fleQ transcriptional regulator FleQ (NCBI) 437, 551
PA1198 PA1198 hypothetical protein (NCBI) 68, 551
PA1199 PA1199 probable lipoprotein (NCBI) 68, 551
PA1200 PA1200 hypothetical protein (NCBI) 68, 551
PA1376 aceK bifunctional isocitrate dehydrogenase kinase/phosphatase protein (NCBI) 513, 551
PA1592 PA1592 hypothetical protein (NCBI) 279, 525
PA1642 selD selenophosphate synthetase (NCBI) 224, 551
PA1643 PA1643 hypothetical protein (NCBI) 224, 551
PA1772 PA1772 ribonuclease activity regulator protein RraA (NCBI) 342, 551
PA2620 clpA ATP-binding protease component ClpA (NCBI) 10, 525
PA2621 clpS ATP-dependent Clp protease adaptor protein ClpS (RefSeq) 279, 525
PA2622 cspD cold-shock protein CspD (NCBI) 279, 525
PA2707 PA2707 hypothetical protein (NCBI) 436, 551
PA2805 PA2805 hypothetical protein (NCBI) 279, 525
PA2820 PA2820 hypothetical protein (NCBI) 397, 551
PA2821 PA2821 probable glutathione S-transferase (NCBI) 397, 551
PA2853 oprI Outer membrane lipoprotein OprI precursor (NCBI) 57, 525
PA3031 PA3031 hypothetical protein (NCBI) 273, 525
PA3385 amrZ alginate and motility regulator Z (NCBI) 455, 525
PA4315 mvaT transcriptional regulator MvaT, P16 subunit (NCBI) 525, 551
PA4463 PA4463 hypothetical protein (NCBI) 15, 525
PA4495 PA4495 hypothetical protein (NCBI) 525, 551
PA4614 mscL large-conductance mechanosensitive channel (NCBI) 279, 525
PA4793 PA4793 hypothetical protein (NCBI) 513, 551
PA4972 PA4972 hypothetical protein (NCBI) 273, 551
PA5191 PA5191 hypothetical protein (NCBI) 159, 551
PA5227 PA5227 hypothetical protein (NCBI) 499, 551
PA5253 algP alginate regulatory protein AlgP (NCBI) 15, 525
PA5288 glnK nitrogen regulatory protein P-II 2 (NCBI) 57, 525
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for PA4495
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend