Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6400H

hypothetical protein VNG6400H

CircVis
Functional Annotations (1)
Function System
zinc ion binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6400H
(Mouseover regulator name to see its description)

VNG6400H is regulated by 31 influences and regulates 0 modules.
Regulators for VNG6400H (31)
Regulator Module Operator
VNG1510C 80 tf
VNG2112C 80 tf
VNG6389G 80 tf
VNG6438G 80 tf
VNG1179C 30 tf
VNG1237C 30 tf
VNG1786H 30 tf
VNG2112C 30 tf
VNG6143H 30 tf
VNG6438G 30 tf
VNG1179C 18 tf
VNG1786H 18 tf
VNG2112C 18 tf
VNG6143H 18 tf
VNG1215G
VNG6143H
245 combiner
VNG1237C 245 tf
VNG2112C 245 tf
VNG6287H 245 tf
VNG6438G 245 tf
VNG1215G
VNG1548C
133 combiner
VNG1215G
VNG6143H
133 combiner
VNG1237C 133 tf
VNG2112C 133 tf
VNG5163G 133 tf
VNG6438G 133 tf
VNG0247C 290 tf
VNG1179C 290 tf
VNG1215G
VNG1886C
290 combiner
VNG1215G
VNG6193H
290 combiner
VNG6438G 290 tf
VNG6438G
VNG0389C
290 combiner

Warning: VNG6400H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 10 motifs predicted.

Motif Table (10)
Motif Id e-value Consensus Motif Logo
1015 0.00e+00 AccAttcaC.caaActacacata
Loader icon
1016 0.00e+00 Aactgatt.AaAtctaAaaaagta
Loader icon
1037 1.10e-03 aAaagaAAT.tTCTctTCAcgaat
Loader icon
1038 1.90e-03 taCgagacaa.gccgacatt.act
Loader icon
1135 1.50e+03 aA.at..tTctgcGGaaa.t
Loader icon
1136 1.50e+03 CgTCggTTcag
Loader icon
1239 2.00e+02 cGTGCgCGCtc
Loader icon
1240 3.10e+02 ACgTA.aA
Loader icon
1425 0.00e+00 AATAGAAATCTTCTCTTCACTGTT
Loader icon
1426 0.00e+00 ACCTAGCTAAATTAATATCGGATT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6400H

VNG6400H is enriched for 1 functions in 2 categories.
Enrichment Table (1)
Function System
zinc ion binding go/ molecular_function
Module neighborhood information for VNG6400H

VNG6400H has total of 62 gene neighbors in modules 18, 30, 80, 133, 245, 290
Gene neighbors (62)
Gene Common Name Description Module membership
VNG0020H hypothetical protein VNG0020H 30, 108, 247
VNG0022H hypothetical protein VNG0022H 30, 254
VNG0023H hypothetical protein VNG0023H 30, 254, 290
VNG0139H hypothetical protein VNG0139H 17, 18, 30, 196
VNG0140H hypothetical protein VNG0140H 18, 26, 30, 239
VNG0148H hypothetical protein VNG0148H 41, 80, 171, 189, 196, 219, 224
VNG0196H hypothetical protein VNG0196H 30, 267, 281
VNG0469H hypothetical protein VNG0469H 30, 91
VNG0470G trp3 daunorubicin resistance ABC transporter ATP-binding protein 30, 91
VNG0512G ppe DNA double-strand break repair protein 18, 121, 177, 196
VNG0532H hypothetical protein VNG0532H 30, 70, 108
VNG0626G maoC2 molybdenum cofactor biosynthesis protein 80
VNG0811H hypothetical protein VNG0811H 30, 87, 138, 147
VNG0869G tfbD transcription initiation factor IIB 18, 91, 95, 212
VNG0926H hypothetical protein VNG0926H 30, 108
VNG1054G ptp polysaccharide biosynthesis protein 133
VNG1260C hypothetical protein VNG1260C 130, 132, 133
VNG1270H hypothetical protein VNG1270H 18, 30, 37, 42
VNG1271H hypothetical protein VNG1271H 18, 30, 37
VNG1646G trpG1 anthranilate synthase subunit beta 30, 48, 64, 87
VNG1648G trpF hypothetical protein VNG1648G 4, 5, 28, 30, 48, 64, 87
VNG1649G trpD anthranilate phosphoribosyltransferase 28, 30, 48, 64, 87, 92
VNG1650H hypothetical protein VNG1650H 4, 5, 30, 34, 35, 245, 295
VNG1732C hypothetical protein VNG1732C 80
VNG1890H hypothetical protein VNG1890H 18, 105, 167
VNG1952H hypothetical protein VNG1952H 18, 28, 30, 42, 68, 80, 91, 108, 121, 135
VNG1953C hypothetical protein VNG1953C 13, 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1956H hypothetical protein VNG1956H 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1959G tgtA1 7-cyano-7-deazaguanine tRNA-ribosyltransferase 53, 129, 130, 132, 133
VNG1986C hypothetical protein VNG1986C 17, 26, 30, 31, 108
VNG2414H hypothetical protein VNG2414H 18, 38, 64
VNG2551G fhuG FhuG 127, 133
VNG2552G yfmF ferrichrome ABC transporter ATP-binding protein 127, 133
VNG5047H None 15, 18, 63
VNG5120H None 18, 37, 198
VNG6157H hypothetical protein VNG6157H 18
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6183C hypothetical protein VNG6183C 15, 18, 213
VNG6184G cat4 cationic amino acid transporter 15, 18, 213
VNG6185H hypothetical protein VNG6185H 15, 18, 213
VNG6186H hypothetical protein VNG6186H 15, 18, 213
VNG6191H hypothetical protein VNG6191H 17, 30, 34, 38, 41, 44, 80, 91
VNG6193H hypothetical protein VNG6193H 17, 32, 34, 38, 41, 42, 44, 80
VNG6196G phoT2 sodium-dependent phosphate transporter 30, 36, 41, 80, 87, 89
VNG6224H hypothetical protein VNG6224H 18, 91
VNG6258C hypothetical protein VNG6258C 18, 30, 108
VNG6292C hypothetical protein VNG6292C 17, 18, 30, 89
VNG6325H hypothetical protein VNG6325H 80
VNG6390H hypothetical protein VNG6390H 4, 26, 30, 34, 35, 245, 295
VNG6400H hypothetical protein VNG6400H 18, 30, 80, 133, 245, 290
VNG6401H hypothetical protein VNG6401H 80, 133, 237, 248
VNG6402H hypothetical protein VNG6402H 80
VNG6418H hypothetical protein VNG6418H 13, 18, 21, 41, 60, 281
VNG6427H hypothetical protein VNG6427H 17, 18, 30, 62, 74, 89, 107
VNG6431H hypothetical protein VNG6431H 17, 26, 30, 38, 178
VNG7011 repH plasmid replication protein RepH 17, 18, 30, 107, 122, 224, 287
VNG7013 hypothetical protein VNG7013 80
VNG7073 hypothetical protein VNG7073 34, 35, 245, 295
VNG7109 hypothetical protein VNG7109 4, 18, 38, 91
VNG7110 hypothetical protein VNG7110 18, 38, 91, 147
VNG7138 hypothetical protein VNG7138 34, 35, 245, 295
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6400H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend