Organism : Methanococcus maripaludis S2 | Module List:
Module 106 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 106

There are 5 regulatory influences for Module 106

Regulator Table (5)
Regulator Name Type
MMP0041
MMP1023
combiner
MMP1065 tf
MMP0460
MMP0799
combiner
MMP0568
H2
combiner
MMP0799
MMP1065
combiner

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
869 1.10e+03 CGAGTAAACCGGATAGCTTAC
Loader icon
870 5.60e+03 TGaagGGCaGtggcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 106 is enriched for following functions.

KEGG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini Hochberg pvalue Genes with function Method
Amino Acid Metabolism kegg subcategory 1.09e-02 3.68e-02 6/37
Metabolism kegg category 5.93e-04 3.44e-03 22/37

GO Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
biosynthetic process biological_process 1.15e-03 2.58e-03 3/37

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Posttranslational modification, protein turnover, chaperones cog subcategory 1.74e-02 2.60e-02 3/37
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 106

There are 37 genes in Module 106

Gene Member Table (37)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
MMP0001 CDS 2762171 chromosome 10104 10385 + hypothetical protein MMP0001 False
MMP0002 CDS 2761917 chromosome 10416 11480 + L-seryl-tRNA selenium transferase False
MMP0030 CDS 2761260 chromosome 45639 47657 + MCM family DNA replication protein False
MMP0084 CDS 2761916 chromosome 95381 96094 - hypothetical protein MMP0084 False
MMP0085 CDS 2761608 chromosome 96131 97177 - hypothetical protein MMP0085 False
MMP0091 CDS 2762101 chromosome 101838 102422 - hypothetical protein MMP0091 False
MMP0239 CDS 2762580 chromosome 244932 245789 + hypothetical protein MMP0239 False
MMP0420 CDS 2762649 chromosome 422287 423252 + CBS domain-containing protein False
MMP0425 CDS 2761929 chromosome 426937 427578 + hypothetical protein MMP0425 False
MMP0426 CDS 2761930 chromosome 427592 428161 + nitroreductase family protein False
MMP0531 CDS 2762275 chromosome 536126 536635 + hypothetical protein MMP0531 False
MMP0535 CDS 2762556 chromosome 540277 540915 - hypothetical protein MMP0535 False
MMP0598 CDS 2761827 chromosome 594165 595451 + phosphoglycerate mutase-related False
MMP0605 CDS 2761661 chromosome 600046 600600 + putative RNA-processing protein False
MMP0630 feoB CDS 2761609 chromosome 621322 623265 - ferrous iron transporter False
MMP0808 CDS 2761810 chromosome 800375 801568 + hypothetical protein MMP0808 False
MMP0809 CDS 2761811 chromosome 801580 802365 + phosphoribosylaminoimidazole carboxylase-like protein False
MMP0958 CDS 2762159 chromosome 946911 947258 - hypothetical protein MMP0958 False
MMP0959 trxB CDS 2762164 chromosome 947275 948177 - FAD-dependent pyridine nucleotide-disulfide oxidoreductase False
MMP0969 CDS 2762511 chromosome 955908 956324 + hypothetical protein MMP0969 False
MMP1001 CDS 2762024 chromosome 985324 986544 + hypothetical protein MMP1001 False
MMP1051 surE CDS 2761383 chromosome 1042663 1043457 - stationary phase survival protein SurE False
MMP1069 CDS 2761578 chromosome 1061440 1062366 - basic helix-loop-helix dimerization domain-containing protein False
MMP1071 CDS 2761816 chromosome 1063111 1063530 - hypothetical protein MMP1071 False
MMP1072 CDS 2761686 chromosome 1063545 1064672 - aminotransferase (subgroup I) aromatic aminotransferase False
MMP1073 ehbC CDS 2761687 chromosome 1064872 1065126 + putative monovalent cation/H+ antiporter subunit G False
MMP1074 ehbD CDS 2761773 chromosome 1065136 1065378 + hypothetical protein MMP1074 False
MMP1091 CDS 2762662 chromosome 1083536 1084384 - ADP-glucose pyrophosphorylase False
MMP1234 CDS 2761859 chromosome 1221654 1222373 + UBA/THIF-type NAD/FAD binding protein False
MMP1235 moaE CDS 2761893 chromosome 1222366 1222791 + molybdopterin biosynthesis MoaE False
MMP1282 CDS 2761258 chromosome 1264697 1265248 - hypothetical protein MMP1282 False
MMP1469 ehbA CDS 2761293 chromosome 1429995 1430297 - putative monovalent cation/H+ antiporter subunit E False
MMP1573 bioD CDS 2761390 chromosome 1523434 1524006 - dethiobiotin synthase False
MMP1598 CDS 2761370 chromosome 1546728 1547282 + hypothetical protein MMP1598 False
MMP1611 CDS 2761575 chromosome 1557924 1558676 - hypothetical protein MMP1611 False
MMP1682 recJ CDS 2761922 chromosome 1624270 1625673 - single stranded DNA-specific exonuclease False
MMP1712 CDS 2762365 chromosome 1649205 1650095 - LysR family transcriptional regulator True

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 106

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.