Organism : Methanococcus maripaludis S2 | Module List :
MMP0239

hypothetical protein MMP0239

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP0239
(Mouseover regulator name to see its description)

MMP0239 is regulated by 16 influences and regulates 0 modules.
Regulators for MMP0239 (16)
Regulator Module Operator
H2 49 ef
MMP0460 49 tf
MMP0499
MMP1065
49 combiner
MMP0032
MMP0257
1 combiner
MMP0209 1 tf
MMP1447 1 tf
MMP0018
MMP0402
75 combiner
MMP0097
MMP0631
75 combiner
MMP0209 75 tf
MMP0402
MMP1015
75 combiner
MMP1023 75 tf
MMP0041
MMP1023
106 combiner
MMP0460
MMP0799
106 combiner
MMP0568
H2
106 combiner
MMP0799
MMP1065
106 combiner
MMP1065 106 tf

Warning: MMP0239 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
663 3.00e+01 CgacCC.c.agG
Loader icon
664 7.60e+03 CcgcTg
Loader icon
759 1.20e+00 tagATatattGgtGa
Loader icon
760 1.90e+01 caAgTcTGgTGg
Loader icon
811 9.70e-01 CCcctCcg
Loader icon
812 7.10e+03 aAAAtA.ccGA
Loader icon
869 1.10e+03 CGAGTAAACCGGATAGCTTAC
Loader icon
870 5.60e+03 TGaagGGCaGtggcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP0239

Warning: No Functional annotations were found!

Module neighborhood information for MMP0239

MMP0239 has total of 116 gene neighbors in modules 1, 49, 75, 106
Gene neighbors (116)
Gene Common Name Description Module membership
Antisense_13 None 49, 129
Antisense_2 None 1, 22
Antisense_23 None 1, 117
Antisense_24 None 5, 49, 90
Antisense_5 None 1, 22
MMP0001 hypothetical protein MMP0001 46, 106, 121, 144
MMP0002 L-seryl-tRNA selenium transferase 12, 46, 76, 106, 121
MMP0008 DP1 DNA polymerase II small subunit 22, 75, 142
MMP0009 putative DNA primase large subunit 75, 151
MMP0020 nickel responsive regulator 49, 123
MMP0030 MCM family DNA replication protein 106, 117
MMP0036 tfe transcription initiation factor E subunit alpha 49, 87, 92, 129
MMP0063 argB acetylglutamate kinase 49, 151
MMP0084 hypothetical protein MMP0084 49, 106
MMP0085 hypothetical protein MMP0085 22, 106
MMP0091 hypothetical protein MMP0091 51, 106
MMP0113 hypothetical protein MMP0113 23, 75, 142
MMP0119 birA biotin--acetyl-CoA-carboxylase ligase 1, 75, 142
MMP0153 aksA trans-homoaconitate synthase 1, 143
MMP0154 hypothetical protein MMP0154 1, 13
MMP0166 MATE family drug/sodium antiporter 1, 28
MMP0167 ABC transporter ATP-binding protein 1, 28
MMP0168 ParR family transcriptional regulator 1, 28
MMP0176 cell division protein CDC48 1, 46
MMP0180 ribC riboflavin synthase 1, 58
MMP0235 hypothetical protein MMP0235 75, 160
MMP0236 hypothetical protein MMP0236 75, 104
MMP0237 hypothetical protein MMP0237 75, 160
MMP0239 hypothetical protein MMP0239 1, 49, 75, 106
MMP0240 hypothetical protein MMP0240 75, 160
MMP0241 hypothetical protein MMP0241 65, 75
MMP0268 truA tRNA pseudouridine synthase A 49, 51
MMP0277 TraB family protein 49, 90
MMP0279 mptG beta-ribofuranosylaminobenzene 5'-phosphate synthase family protein 49, 90
MMP0302 hypothetical protein MMP0302 49, 90
MMP0307 hypothetical protein MMP0307 33, 49, 153
MMP0392 purD phosphoribosylamine--glycine ligase 4, 75, 104
MMP0420 CBS domain-containing protein 13, 106
MMP0425 hypothetical protein MMP0425 57, 102, 106
MMP0426 nitroreductase family protein 57, 102, 106, 153
MMP0450 ferredoxin 1, 70
MMP0451 hypothetical protein MMP0451 1, 70
MMP0452 hypothetical protein MMP0452 75, 160
MMP0453 neutral zinc metallopeptidase 22, 75
MMP0458 hypothetical protein MMP0458 75, 160
MMP0531 hypothetical protein MMP0531 106, 140
MMP0535 hypothetical protein MMP0535 57, 102, 106
MMP0536 hypothetical protein MMP0536 1, 28
MMP0562 hypothetical protein MMP0562 49, 124
MMP0595 hypothetical protein MMP0595 75, 160
MMP0598 phosphoglycerate mutase-related 106, 151
MMP0605 putative RNA-processing protein 12, 106
MMP0608 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein 1, 28
MMP0630 feoB ferrous iron transporter 28, 76, 106, 121
MMP0635 ABC transporter ATPase 75, 108
MMP0636 hypothetical protein MMP0636 75, 160
MMP0643 hypothetical protein MMP0643 49, 65
MMP0685 N-6 adenine-specific DNA methylase 1, 144
MMP0723 hypothetical protein MMP0723 75, 160
MMP0725 putative integral membrane protein 49, 75, 90, 151
MMP0727 uvrB excinuclease ABC subunit B 49, 142
MMP0742 hypothetical protein MMP0742 23, 49
MMP0808 hypothetical protein MMP0808 12, 106
MMP0809 phosphoribosylaminoimidazole carboxylase-like protein 12, 106
MMP0876 cofG FO synthase subunit 1 1, 129
MMP0902 hypothetical protein MMP0902 12, 49, 55
MMP0909 hypothetical protein MMP0909 75, 104
MMP0918 asnB glutamine-hydrolyzing asparagine synthase 49, 115
MMP0934 hypothetical protein MMP0934 75, 126
MMP0958 hypothetical protein MMP0958 57, 102, 106
MMP0959 trxB FAD-dependent pyridine nucleotide-disulfide oxidoreductase 57, 102, 106
MMP0969 hypothetical protein MMP0969 106, 115
MMP1001 hypothetical protein MMP1001 57, 102, 106
MMP1051 surE stationary phase survival protein SurE 12, 28, 106
MMP1069 basic helix-loop-helix dimerization domain-containing protein 106, 115
MMP1071 hypothetical protein MMP1071 1, 106
MMP1072 aminotransferase (subgroup I) aromatic aminotransferase 1, 106
MMP1073 ehbC putative monovalent cation/H+ antiporter subunit G 35, 106
MMP1074 ehbD hypothetical protein MMP1074 17, 106
MMP1091 ADP-glucose pyrophosphorylase 99, 106
MMP1140 fdxA ferredoxin 1, 46
MMP1141 ATP-dependent helicase 75, 142
MMP1162 beta-lactamase domain-containing protein 75, 108
MMP1185 hydrogen uptake protein:hydrogenase maturation protease HycI 1, 46
MMP1218 hypothetical protein MMP1218 12, 46, 49
MMP1220 glgP alpha-glucan phosphorylase 50, 75
MMP1234 UBA/THIF-type NAD/FAD binding protein 33, 54, 55, 106
MMP1235 moaE molybdopterin biosynthesis MoaE 49, 55, 106, 117, 150
MMP1238 bioB biotin synthase 1, 153
MMP1240 Sep-tRNA:Cys-tRNA synthetase 1, 55
MMP1241 hypothetical protein MMP1241 1, 55, 94, 117
MMP1282 hypothetical protein MMP1282 49, 102, 106, 150
MMP1283 hypothetical protein MMP1283 49, 102, 150
MMP1290 GTP-binding protein 49, 115
MMP1295 glucose-6-phosphate isomerase 43, 75
MMP1343 hypothetical protein MMP1343 49, 151
MMP1345 undecaprenyl pyrophospahte synthetase-like protein 49, 111
MMP1346 basic helix-loop-helix dimerization domain-containing protein 49, 67, 142
MMP1372 manB phosphomannomutase 49, 94, 152
MMP1430 cation transporter 49, 115
MMP1431 2pgk 2-phosphoglycerate kinase 49, 51
MMP1469 ehbA putative monovalent cation/H+ antiporter subunit E 10, 106
MMP1549 AP endonuclease 1, 94, 152
MMP1550 NADP oxidoreductase, coenzyme F420-dependent 1, 58
MMP1551 ffh signal recognition particle protein Srp54 49, 55, 83
MMP1573 bioD dethiobiotin synthase 28, 106
MMP1598 hypothetical protein MMP1598 76, 102, 106
MMP1603 ferredoxin 12, 49
MMP1605 pyruvate kinase 1, 54, 146, 166
MMP1606 flavoprotein:DNA/pantothenate metabolism flavoprotein 1, 13, 49
MMP1607 hypothetical protein MMP1607 49, 55, 83
MMP1611 hypothetical protein MMP1611 21, 106
MMP1682 recJ single stranded DNA-specific exonuclease 21, 106
MMP1712 LysR family transcriptional regulator 19, 106
Unanno_42 None 49, 90
Unanno_62 None 49, 90
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP0239
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend