Organism : Methanococcus maripaludis S2 | Module List :
MMP1235 moaE

molybdopterin biosynthesis MoaE

CircVis
Functional Annotations (3)
Function System
Molybdopterin converting factor, large subunit cog/ cog
Mo-molybdopterin cofactor biosynthetic process go/ biological_process
Sulfur relay system kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP1235
(Mouseover regulator name to see its description)

MMP1235 is regulated by 20 influences and regulates 0 modules.
Regulators for MMP1235 moaE (20)
Regulator Module Operator
H2 49 ef
MMP0460 49 tf
MMP0499
MMP1065
49 combiner
MMP0041
MMP1023
106 combiner
MMP0460
MMP0799
106 combiner
MMP0568
H2
106 combiner
MMP0799
MMP1065
106 combiner
MMP1065 106 tf
MMP0460 55 tf
MMP0527 55 tf
MMP0907
MMP1023
55 combiner
MMP0907
MMP1646
55 combiner
MMP1023 55 tf
MMP1447 55 tf
MMP0527
MMP1210
117 combiner
MMP0568 117 tf
MMP1065 117 tf
MMP1065
MMP1210
117 combiner
MMP0527
MMP1100
150 combiner
MMP1376 150 tf

Warning: MMP1235 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 10 motifs predicted.

Motif Table (10)
Motif Id e-value Consensus Motif Logo
759 1.20e+00 tagATatattGgtGa
Loader icon
760 1.90e+01 caAgTcTGgTGg
Loader icon
771 2.40e+01 gcgatgggg.ggAagA.taCctg
Loader icon
772 1.60e+03 AatTGgTGAa
Loader icon
869 1.10e+03 CGAGTAAACCGGATAGCTTAC
Loader icon
870 5.60e+03 TGaagGGCaGtggcA
Loader icon
889 2.10e+01 TTTcttctagaaTATcccgGgtGA
Loader icon
890 3.40e+01 TTTTCcagatTttg
Loader icon
949 5.10e+02 TacgGggtGtT
Loader icon
950 2.10e+03 cttCatatt.cA.AatccccTTc
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP1235

MMP1235 is enriched for 3 functions in 3 categories.
Enrichment Table (3)
Function System
Molybdopterin converting factor, large subunit cog/ cog
Mo-molybdopterin cofactor biosynthetic process go/ biological_process
Sulfur relay system kegg/ kegg pathway
Module neighborhood information for MMP1235

MMP1235 has total of 123 gene neighbors in modules 49, 55, 106, 117, 150
Gene neighbors (123)
Gene Common Name Description Module membership
Antisense_10 None 2, 43, 150
Antisense_13 None 49, 129
Antisense_23 None 1, 117
Antisense_24 None 5, 49, 90
MMP0001 hypothetical protein MMP0001 46, 106, 121, 144
MMP0002 L-seryl-tRNA selenium transferase 12, 46, 76, 106, 121
MMP0020 nickel responsive regulator 49, 123
MMP0030 MCM family DNA replication protein 106, 117
MMP0036 tfe transcription initiation factor E subunit alpha 49, 87, 92, 129
MMP0052 putative CBS domain-containing signal transduction protein 13, 117
MMP0063 argB acetylglutamate kinase 49, 151
MMP0069 methylated-DNA--protein-cysteine methyltransferase 23, 150
MMP0084 hypothetical protein MMP0084 49, 106
MMP0085 hypothetical protein MMP0085 22, 106
MMP0086 tfx putative transcriptional regulator 150, 160
MMP0091 hypothetical protein MMP0091 51, 106
MMP0102 pcm protein-L-isoaspartate O-methyltransferase 2, 43, 150
MMP0120 hypothetical protein MMP0120 55, 142
MMP0121 hypothetical protein MMP0121 55, 57
MMP0177 hypothetical protein MMP0177 83, 117, 152
MMP0190 hypothetical protein MMP0190 150, 159
MMP0225 gldA glycerol dehydrogenase 117, 142
MMP0226 ExsB family transcriptional regulator 13, 117
MMP0239 hypothetical protein MMP0239 1, 49, 75, 106
MMP0268 truA tRNA pseudouridine synthase A 49, 51
MMP0277 TraB family protein 49, 90
MMP0279 mptG beta-ribofuranosylaminobenzene 5'-phosphate synthase family protein 49, 90
MMP0289 hypD hydrogenase expression/formation protein HypD 12, 117
MMP0302 hypothetical protein MMP0302 49, 90
MMP0307 hypothetical protein MMP0307 33, 49, 153
MMP0420 CBS domain-containing protein 13, 106
MMP0425 hypothetical protein MMP0425 57, 102, 106
MMP0426 nitroreductase family protein 57, 102, 106, 153
MMP0439 pyrD dihydroorotate dehydrogenase 1B 117, 119
MMP0482 hypothetical protein MMP0482 54, 55
MMP0483 hypothetical protein MMP0483 54, 55
MMP0528 hypothetical protein MMP0528 23, 150
MMP0531 hypothetical protein MMP0531 106, 140
MMP0535 hypothetical protein MMP0535 57, 102, 106
MMP0543 hypothetical protein MMP0543 55, 159
MMP0544 MoaA/nifB/pqqE family protein 55, 142
MMP0545 putative molybdopterin biosynthesis protein MoeA/LysR substrate binding-domain-containing protein 55, 142
MMP0562 hypothetical protein MMP0562 49, 124
MMP0598 phosphoglycerate mutase-related 106, 151
MMP0605 putative RNA-processing protein 12, 106
MMP0630 feoB ferrous iron transporter 28, 76, 106, 121
MMP0638 hypothetical protein MMP0638 54, 55
MMP0643 hypothetical protein MMP0643 49, 65
MMP0725 putative integral membrane protein 49, 75, 90, 151
MMP0727 uvrB excinuclease ABC subunit B 49, 142
MMP0742 hypothetical protein MMP0742 23, 49
MMP0788 hypothetical protein MMP0788 58, 117
MMP0808 hypothetical protein MMP0808 12, 106
MMP0809 phosphoribosylaminoimidazole carboxylase-like protein 12, 106
MMP0849 L-lysine/ homoserine-homoserine lactone exporter family protein 95, 117
MMP0902 hypothetical protein MMP0902 12, 49, 55
MMP0903 hypothetical protein MMP0903 33, 54, 55
MMP0918 asnB glutamine-hydrolyzing asparagine synthase 49, 115
MMP0958 hypothetical protein MMP0958 57, 102, 106
MMP0959 trxB FAD-dependent pyridine nucleotide-disulfide oxidoreductase 57, 102, 106
MMP0969 hypothetical protein MMP0969 106, 115
MMP0992 hypothetical protein MMP0992 55, 117
MMP1001 hypothetical protein MMP1001 57, 102, 106
MMP1019 PEGA domain-containing protein 23, 150
MMP1051 surE stationary phase survival protein SurE 12, 28, 106
MMP1065 BadM/Rrf2 family transcriptional regulator 55, 152
MMP1069 basic helix-loop-helix dimerization domain-containing protein 106, 115
MMP1071 hypothetical protein MMP1071 1, 106
MMP1072 aminotransferase (subgroup I) aromatic aminotransferase 1, 106
MMP1073 ehbC putative monovalent cation/H+ antiporter subunit G 35, 106
MMP1074 ehbD hypothetical protein MMP1074 17, 106
MMP1088 group 1 glycosyl transferase 31, 117
MMP1091 ADP-glucose pyrophosphorylase 99, 106
MMP1118 hypothetical protein MMP1118 83, 117
MMP1218 hypothetical protein MMP1218 12, 46, 49
MMP1234 UBA/THIF-type NAD/FAD binding protein 33, 54, 55, 106
MMP1235 moaE molybdopterin biosynthesis MoaE 49, 55, 106, 117, 150
MMP1236 hypothetical protein MMP1236 22, 55, 117, 142, 152
MMP1237 hypothetical protein MMP1237 50, 150
MMP1240 Sep-tRNA:Cys-tRNA synthetase 1, 55
MMP1241 hypothetical protein MMP1241 1, 55, 94, 117
MMP1256 hypothetical protein MMP1256 150, 159
MMP1282 hypothetical protein MMP1282 49, 102, 106, 150
MMP1283 hypothetical protein MMP1283 49, 102, 150
MMP1290 GTP-binding protein 49, 115
MMP1294 glgA starch synthase 43, 150, 166
MMP1330 hydrogenase assembly chaperone hypC/hupF 100, 117
MMP1343 hypothetical protein MMP1343 49, 151
MMP1345 undecaprenyl pyrophospahte synthetase-like protein 49, 111
MMP1346 basic helix-loop-helix dimerization domain-containing protein 49, 67, 142
MMP1372 manB phosphomannomutase 49, 94, 152
MMP1387 hypothetical protein MMP1387 33, 73, 150
MMP1428 hypothetical protein MMP1428 55, 83
MMP1430 cation transporter 49, 115
MMP1431 2pgk 2-phosphoglycerate kinase 49, 51
MMP1447 Cro repressor family protein 22, 117
MMP1452 ehaE hypothetical protein MMP1452 22, 117
MMP1453 ehaF hypothetical protein MMP1453 22, 117
MMP1454 ehaG hypothetical protein MMP1454 66, 117, 133
MMP1456 ehaI hypothetical protein MMP1456 66, 117, 133
MMP1459 ehaL hypothetical protein MMP1459 66, 117, 133
MMP1461 ehaN energy conserving hydrogenase A small subunit 117, 133
MMP1469 ehbA putative monovalent cation/H+ antiporter subunit E 10, 106
MMP1487 gapN aldehyde dehydrogenase 55, 152
MMP1551 ffh signal recognition particle protein Srp54 49, 55, 83
MMP1552 3-octaprenyl-4-hydroxybenzoate carboxy-lyase 54, 150
MMP1573 bioD dethiobiotin synthase 28, 106
MMP1598 hypothetical protein MMP1598 76, 102, 106
MMP1603 ferredoxin 12, 49
MMP1606 flavoprotein:DNA/pantothenate metabolism flavoprotein 1, 13, 49
MMP1607 hypothetical protein MMP1607 49, 55, 83
MMP1608 hypothetical protein MMP1608 150, 160
MMP1611 hypothetical protein MMP1611 21, 106
MMP1619 molybdenum cofactor biosynthesis protein MoeA 117, 152
MMP1653 hypothetical protein MMP1653 150, 166
MMP1662 cbiF precorrin-4 C11-methyltransferase 66, 117
MMP1665 HEAT domain-containing protein 66, 117
MMP1679 hypothetical protein MMP1679 117, 151
MMP1682 recJ single stranded DNA-specific exonuclease 21, 106
MMP1712 LysR family transcriptional regulator 19, 106
Unanno_42 None 49, 90
Unanno_49 None 95, 117
Unanno_62 None 49, 90
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP1235
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend