Organism : Pseudomonas aeruginosa | Module List :
PA0279

probable transcriptional regulator (NCBI)

CircVis
Functional Annotations (4)
Function System
Predicted transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for PA0279
(Mouseover regulator name to see its description)

PA0279 is regulated by 32 influences and regulates 12 modules.
Regulators for PA0279 (32)
Regulator Module Operator
PA0163 30 tf
PA0279 30 tf
PA0816 30 tf
PA0828 30 tf
PA0864 30 tf
PA1145 30 tf
PA1399 30 tf
PA1413 30 tf
PA1570 30 tf
PA1998 30 tf
PA2376 30 tf
PA2921 30 tf
PA3133 30 tf
PA3830 30 tf
PA4238 30 tf
PA5116 30 tf
PA5324 30 tf
PA5382 30 tf
PA0032 507 tf
PA0279 507 tf
PA1226 507 tf
PA1374 507 tf
PA1399 507 tf
PA1467 507 tf
PA1998 507 tf
PA2050 507 tf
PA3133 507 tf
PA4270 507 tf
PA4341 507 tf
PA4581 507 tf
PA4989 507 tf
PA5431 507 tf

Warning: PA0279 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
2894 2.60e+01 AATAGTTTCTGTATTAAATACCT
Loader icon
2895 1.90e+02 GtaGc.GGCatG.AgTtgtgaAc
Loader icon
3828 4.50e+02 cgG.TTTTTcC
Loader icon
3829 3.30e+04 CTAcaAaaA.tAAcata..AA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for PA0279

PA0279 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Predicted transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for PA0279

PA0279 has total of 50 gene neighbors in modules 30, 507
Gene neighbors (50)
Gene Common Name Description Module membership
PA0211 mdcD acetyl-CoA carboxylase beta subunit (NCBI) 24, 507
PA0215 PA0215 probable transporter (NCBI) 330, 507
PA0216 PA0216 probable transporter (NCBI) 24, 507
PA0276 PA0276 hypothetical protein (NCBI) 30, 34
PA0279 PA0279 probable transcriptional regulator (NCBI) 30, 507
PA0339 PA0339 hypothetical protein (NCBI) 30, 483
PA0464 creC two-component sensor CreC (NCBI) 351, 507
PA0488 PA0488 hypothetical protein (NCBI) 330, 507
PA0581 PA0581 hypothetical protein (NCBI) 507, 541
PA0864 PA0864 probable transcriptional regulator (NCBI) 30, 323
PA0894 PA0894 hypothetical protein (NCBI) 30, 461
PA0995 ogt methylated-DNA--protein-cysteinemethyltransferase (NCBI) 30, 229
PA1129 PA1129 probable fosfomycin resistance protein (NCBI) 30, 283
PA1226 PA1226 probable transcriptional regulator (NCBI) 507, 542
PA1401 PA1401 hypothetical protein (NCBI) 295, 507
PA1411 PA1411 hypothetical protein (NCBI) 246, 507
PA1413 PA1413 probable transcriptional regulator (NCBI) 30, 326
PA1466 PA1466 hypothetical protein (NCBI) 266, 507
PA1468 PA1468 hypothetical protein (NCBI) 44, 507
PA1625 PA1625 hypothetical protein (NCBI) 30, 450
PA1885 PA1885 hypothetical protein (NCBI) 30, 44
PA2027 PA2027 hypothetical protein (NCBI) 79, 507
PA2028 PA2028 probable transcriptional regulator (NCBI) 268, 507
PA2125 PA2125 probable aldehyde dehydrogenase (NCBI) 23, 507
PA2563 PA2563 probable sulfate transporter (NCBI) 438, 507
PA2574 alkB1 alkane-1-monooxygenase (NCBI) 30, 192
PA2651 PA2651 hypothetical protein (NCBI) 30, 117
PA2928 PA2928 hypothetical protein (NCBI) 30, 190
PA3265 PA3265 probable transporter (NCBI) 20, 507
PA3362 PA3362 hypothetical protein (NCBI) 30, 34
PA3457 PA3457 hypothetical protein (NCBI) 30, 33
PA3829 PA3829 hypothetical protein (NCBI) 30, 507
PA3985 PA3985 hypothetical protein (NCBI) 30, 190
PA4034 aqpZ aquaporin Z (NCBI) 30, 321
PA4289 PA4289 probable transporter (NCBI) 30, 500
PA4334 PA4334 probable transport protein (NCBI) 30, 507
PA4486 PA4486 hypothetical protein (NCBI) 30, 320
PA4862 PA4862 probable ATP-binding component of ABC transporter (NCBI) 386, 507
PA4982 PA4982 probable two-component sensor (NCBI) 497, 507
PA4984 PA4984 probable transcriptional regulator (NCBI) 245, 507
PA5081 PA5081 hypothetical protein (NCBI) 283, 507
PA5211 PA5211 hypothetical protein (NCBI) 30, 44
PA5249 PA5249 hypothetical protein (NCBI) 507, 550
PA5290 PA5290 hypothetical protein (NCBI) 16, 30
PA5324 PA5324 probable transcriptional regulator (NCBI) 30, 337
PA5327 PA5327 probable oxidoreductase (NCBI) 180, 507
PA5382 PA5382 probable transcriptional regulator (NCBI) 30, 536
PA5383 PA5383 hypothetical protein (NCBI) 30, 536
PA5431 PA5431 probable transcriptional regulator (NCBI) 497, 507
PA5537 PA5537 hypothetical protein (NCBI) 134, 507
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for PA0279
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend