Organism : Bacillus subtilis | Module List:
Module 265 Profile

GeneModule member RegulatorRegulator MotifMotif
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 265

There are 11 regulatory influences for Module 265

Regulator Table (11)
Regulator Name Type
BSU00700 tf
BSU15970 tf
BSU26720 tf
BSU33950 tf
BSU24520 tf
BSU37160 tf
BSU05670 tf
BSU01010 tf
BSU09520 tf
BSU02680 tf
BSU00470 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
5470 1.80e-04 CCgGCTGgaAAagCTccCaCttC
Loader icon
5471 3.20e+02 GCACAGGAAAACAGAGGTGAAGAC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 265 is enriched for following functions.

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Cell wall/membrane/envelope biogenesis cog subcategory 6.24e-03 1.03e-02 3/18
Carbohydrate transport and metabolism cog subcategory 2.98e-02 4.50e-02 3/18
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 265

There are 18 genes in Module 265

Gene Member Table (18)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
BSU01750 ybbP CDS None chromosome 196202 197023 + hypothetical protein (RefSeq) False
BSU01760 ybbR CDS None chromosome 197016 198467 + hypothetical protein (RefSeq) False
BSU01770 glmM CDS None chromosome 198486 199832 + phosphoglucosamine mutase (RefSeq) False
BSU13300 mgtE CDS None chromosome 1395321 1396676 + magnesium transporter (RefSeq) False
BSU14030 ykuC CDS None chromosome 1474451 1475743 - putative efflux transporter (RefSeq) False
BSU22170 ypsC CDS None chromosome 2329272 2330429 - putative methylase with RNA interaction domain (RefSeq) False
BSU22310 recU CDS None chromosome 2339999 2340619 + Holliday junction-specific endonuclease (RefSeq) False
BSU22770 mtrB CDS None chromosome 2383731 2383958 - transcription attenuation protein MtrB (RefSeq) False
BSU29580 ytbJ CDS None chromosome 3024920 3025996 - thiamine biosynthesis protein ThiI (RefSeq) False
BSU29590 iscS CDS None chromosome 3026000 3027145 - cysteine desulfurase (RefSeq) False
BSU29790 murC CDS None chromosome 3047227 3048525 - UDP-N-acetylmuramate--L-alanine ligase (RefSeq) False
BSU30480 ytqA CDS None chromosome 3119048 3120016 + putative Fe-S oxidoreductase (RefSeq) False
BSU31875 BSU31875 DUMMY None chromosome 0 0 + None False
BSU35700 tagH CDS None chromosome 3672594 3674177 - ATP-binding teichoic acid precursor transporter component (RefSeq) False
BSU36230 ywqF CDS None chromosome 3728515 3729837 - UDP-glucose dehydrogenase (RefSeq) False
BSU37000 prmC CDS None chromosome 3795240 3796106 - glutamine methylase of release factor 1 (and perhaps others) at a GGQ site (RefSeq) False
BSU37010 prfA CDS None chromosome 3796108 3797178 - peptide chain release factor 1 (RefSeq) False
BSU37020 ywkD CDS None chromosome 3797304 3797690 + putative lyase (RefSeq) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.