Organism : Bacteroides thetaiotaomicron VPI-5482 | Module List :
NP_811468.1 BT_2555

None

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for NP_811468.1
(Mouseover regulator name to see its description)

Warning: No Regulators were found for NP_811468.1!

Warning: NP_811468.1 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
6428 1.30e-07 tcTAtCTTTGCagc
Loader icon
6429 1.40e+02 CACAGCCATACTGGTACGGAGTGG
Loader icon
6654 9.40e+04 CCcCaTcGGCG
Loader icon
6655 2.90e+04 GCCCCG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for NP_811468.1

Warning: No Functional annotations were found!

Module neighborhood information for NP_811468.1

NP_811468.1 has total of 70 gene neighbors in modules 358, 472
Gene neighbors (70)
Gene Common Name Description Module membership
NP_809111.1 BT_0198 None 179, 358
NP_809271.1 BT_0358 None 179, 358
NP_809456.1 BT_0543 None 242, 472
NP_809457.1 BT_0544 None 319, 472
NP_809458.1 BT_0545 None 80, 472
NP_809464.1 asnB None 415, 472
NP_809465.1 BT_0552 None 58, 472
NP_809466.1 BT_0553 None 91, 472
NP_809552.1 BT_0639 None 163, 358
NP_809559.1 BT_0646 None 114, 472
NP_809575.1 BT_0662 None 45, 472
NP_809581.1 BT_0668 None 45, 472
NP_809623.1 BT_0710 None 168, 472
NP_809660.1 BT_0747 None 358, 364
NP_809713.1 BT_0800 None 241, 472
NP_809714.1 BT_0801 None 241, 472
NP_809760.1 BT_0847 None 429, 472
NP_810145.1 BT_1232 None 347, 358
NP_810161.1 BT_1248 None 277, 358
NP_810318.1 BT_1405 None 284, 472
NP_810456.1 BT_1543 None 179, 358
NP_810819.1 BT_1906 None 358, 415
NP_810825.1 BT_1912 None 373, 472
NP_810877.1 BT_1964 None 358, 374
NP_810878.1 BT_1965 None 358, 374
NP_810880.1 BT_1967 None 358, 374
NP_810894.1 BT_1981 None 263, 472
NP_810982.1 BT_2069 None 137, 358
NP_811009.1 BT_2096 None 349, 358
NP_811010.1 BT_2097 None 349, 358
NP_811015.1 BT_2102 None 273, 358
NP_811091.1 BT_2178 None 156, 472
NP_811190.1 BT_2277 None 179, 472
NP_811256.1 BT_2343 None 356, 358
NP_811259.1 BT_2346 None 144, 358
NP_811269.1 BT_2356 None 179, 358
NP_811270.1 BT_2357 None 179, 358
NP_811292.1 BT_2379 None 347, 358
NP_811361.1 BT_2448 None 308, 472
NP_811449.1 BT_2536 None 242, 358
NP_811468.1 BT_2555 None 358, 472
NP_811488.1 BT_2575 None 149, 358
NP_811681.1 BT_2769 None 91, 472
NP_811682.1 BT_2770 None 73, 472
NP_811772.1 BT_2860 None 347, 358
NP_811840.1 BT_2928 None 235, 358
NP_811884.1 BT_2972 None 179, 472
NP_811885.1 BT_2973 None 179, 472
NP_811886.1 BT_2974 None 235, 472
NP_811894.1 BT_2982 None 319, 358
NP_811968.1 BT_3056 None 261, 472
NP_812024.1 BT_3112 None 91, 472
NP_812056.1 BT_3144 None 360, 472
NP_812106.1 BT_3194 None 138, 472
NP_812128.1 BT_3216 None 132, 358
NP_812132.1 BT_3220 None 358, 451
NP_812182.1 BT_3270 None 273, 472
NP_812184.1 BT_3272 None 349, 472
NP_812185.1 BT_3273 None 349, 358
NP_812187.1 BT_3275 None 50, 472
NP_812445.1 BT_3533 None 58, 358
NP_812446.1 BT_3534 None 87, 358
NP_812450.1 BT_3538 None 358, 428
NP_812658.1 BT_3747 None 358, 415
NP_813052.1 BT_4141 None 15, 472
NP_813343.1 BT_4432 None 137, 358
NP_813403.1 BT_4492 None 358, 415
NP_813452.1 BT_4541 None 179, 358
NP_813496.1 BT_4585 None 4, 472
NP_813536.1 BT_4625 None 267, 472
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for NP_811468.1
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend