Organism : Campylobacter jejuni | Module List :
Cj1054c murC

UDP-N-acetylmuramate--alanine ligase (NCBI ptt file)

CircVis
Functional Annotations (14)
Function System
UDP-N-acetylmuramate-alanine ligase cog/ cog
structural constituent of ribosome go/ molecular_function
ATP binding go/ molecular_function
cytoplasm go/ cellular_component
ribosome go/ cellular_component
translation go/ biological_process
regulation of cell shape go/ biological_process
UDP-N-acetylmuramate-L-alanine ligase activity go/ molecular_function
peptidoglycan biosynthetic process go/ biological_process
cell division go/ biological_process
D-Glutamine and D-glutamate metabolism kegg/ kegg pathway
Peptidoglycan biosynthesis kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
murC tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Cj1054c
(Mouseover regulator name to see its description)

Cj1054c is regulated by 8 influences and regulates 0 modules.
Regulators for Cj1054c murC (8)
Regulator Module Operator
Cj0135 95 tf
Cj0287c 95 tf
Cj0368c 95 tf
Cj0571 95 tf
Cj1024c 95 tf
Cj0287c 75 tf
Cj0368c 75 tf
Cj0480c 75 tf

Warning: Cj1054c Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7532 5.20e+01 AGaTTTTaTcGgTTATAAtcctTA
Loader icon
7533 4.60e+03 CaccTttcTGTG
Loader icon
7572 6.50e-02 cTctaATTtt.gCtT
Loader icon
7573 1.20e+04 CAAAGCTCATTTTTTAAGAAAGG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Cj1054c

Cj1054c is enriched for 14 functions in 3 categories.
Enrichment Table (14)
Function System
UDP-N-acetylmuramate-alanine ligase cog/ cog
structural constituent of ribosome go/ molecular_function
ATP binding go/ molecular_function
cytoplasm go/ cellular_component
ribosome go/ cellular_component
translation go/ biological_process
regulation of cell shape go/ biological_process
UDP-N-acetylmuramate-L-alanine ligase activity go/ molecular_function
peptidoglycan biosynthetic process go/ biological_process
cell division go/ biological_process
D-Glutamine and D-glutamate metabolism kegg/ kegg pathway
Peptidoglycan biosynthesis kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
murC tigr/ tigrfam
Module neighborhood information for Cj1054c

Cj1054c has total of 47 gene neighbors in modules 75, 95
Gene neighbors (47)
Gene Common Name Description Module membership
Cj0027 pyrG CTP synthase (NCBI ptt file) 10, 95
Cj0066c aroQ 3-dehydroquinate dehydratase (NCBI ptt file) 75, 166
Cj0077c cdtC cytolethal distending toxin (NCBI ptt file) 39, 95
Cj0078c cdtB cytolethal distending toxin (NCBI ptt file) 44, 95
Cj0079c cdtA cytolethal distending toxin (NCBI ptt file) 44, 95
Cj0104 atpH ATP synthase F1 sector delta subunit (NCBI ptt file) 95, 120
Cj0135 Cj0135 hypothetical protein Cj0135 (NCBI ptt file) 95, 125
Cj0194 folE GTP cyclohydrolase I (NCBI ptt file) 95, 160
Cj0201c Cj0201c putative integral membrane protein (NCBI ptt file) 75, 155
Cj0237 cynT carbonic anyhydrase (NCBI ptt file) 75, 155
Cj0253 Cj0253 hypothetical protein Cj0253 (NCBI ptt file) 28, 75
Cj0285c cheV chemotaxis protein (NCBI ptt file) 75, 82
Cj0287c greA transcription elongation factor (NCBI ptt file) 95, 160
Cj0309c Cj0309c putative efflux protein (NCBI ptt file) 52, 95
Cj0310c Cj0310c putative efflux protein (NCBI ptt file) 95, 158
Cj0311 Cj0311 ctc protein homolog (NCBI ptt file) 30, 95
Cj0312 pth peptidyl-tRNA hydrolase (NCBI ptt file) 94, 95
Cj0351 fliN flagellar motor switch protein (NCBI ptt file) 75, 91
Cj0368c Cj0368c transcriptional regulatory protein (NCBI ptt file) 28, 75
Cj0369c Cj0369c ferredoxin domain-containing integral membrane protein (NCBI ptt file) 75, 87
Cj0370 rpsU 30S ribosomal protein S21 (NCBI ptt file) 49, 75
Cj0391c Cj0391c hypothetical protein Cj0391c (NCBI ptt file) 75, 157
Cj0537 oorB OORB subunit of 2-oxoglutarate:acceptor oxidoreductase (NCBI ptt file) 75, 87
Cj0772c Cj0772c putative periplasmic protein (NCBI ptt file) 10, 95
Cj0863c xerD DNA recombinase (NCBI ptt file) 35, 95
Cj0918c prsA ribose-phosphate pyrophosphokinase (NCBI ptt file) 91, 95
Cj0999c Cj0999c putative integral membrane protein (NCBI ptt file) 28, 75
Cj1022c Cj1022c putative integral membrane protein (NCBI ptt file) 74, 95
Cj1054c murC UDP-N-acetylmuramate--alanine ligase (NCBI ptt file) 75, 95
Cj1064 Cj1064 None 20, 95
Cj1140 Cj1140 hypothetical protein Cj1140 (NCBI ptt file) 95, 120
Cj1196c gpsA glycerol-3-phosphate dehydrogenase [NAD(P)+] (NCBI ptt file) 95, 166
Cj1240c Cj1240c putative periplasmic protein (NCBI ptt file) 75, 155
Cj1291c accB putative biotin carboxyl carrier protein of acetyl-CoA carboxylase (NCBI ptt file) 10, 75
Cj1348c Cj1348c putative coiled-coil protein (NCBI ptt file) 75, 92
Cj1369 Cj1369 putative transmembrane transport protein (NCBI ptt file) 34, 95
Cj1450 Cj1450 putative ATP/GTP-binding protein (NCBI ptt file) 42, 75
Cj1511c fdhA putative formate dehydrogenase large subunit (Selenocysteine containing) (NCBI ptt file) 95, 166
Cj1513c Cj1513c possible periplasmic protein (NCBI ptt file) 42, 95
Cj1542 Cj1542 hypothetical protein Cj1542 (NCBI ptt file) 95, 120
Cj1551c Cj1551c putative type I restriction enzyme S protein (NCBI ptt file) 37, 75
Cj1576c nuoD NADH dehydrogenase I chain D (NCBI ptt file) 95, 166
Cj1578c nuoB NADH dehydrogenase I chain B (NCBI ptt file) 95, 166
Cj1579c nuoA NADH dehydrogenase I chain A (NCBI ptt file) 95, 166
Cj1631c Cj1631c hypothetical protein Cj1631c (NCBI ptt file) 50, 75
Cj1632c Cj1632c putative periplasmic protein (NCBI ptt file) 75, 157
Cj1637c Cj1637c putative periplasmic protein (NCBI ptt file) 75, 165
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Cj1054c
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend