Organism : Halobacterium salinarum NRC-1 | Module List :
VNG1405C

hypothetical protein VNG1405C

CircVis
Functional Annotations (1)
Function System
Predicted transcriptional regulators cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG1405C
(Mouseover regulator name to see its description)

VNG1405C is regulated by 25 influences and regulates 15 modules.
Regulators for VNG1405C (25)
Regulator Module Operator
VNG0389C
VNG1548C
151 combiner
VNG1510C
VNG6288C
151 combiner
VNG1616C
VNG0826C
151 combiner
VNG1886C 151 tf
VNG6389G 151 tf
VNG0039H
VNG1786H
73 combiner
VNG0293H 73 tf
VNG0651G 73 tf
VNG0835G
VNG1123G
73 combiner
VNG1096H 73 tf
VNG1123G
VNG0156C
73 combiner
VNG1786H
VNG2641H
73 combiner
VNG0651G 11 tf
VNG1123G
VNG6143H
11 combiner
VNG1922G 11 tf
VNG6288C 11 tf
VNG0651G 273 tf
VNG1096H 273 tf
VNG1123G
VNG1786H
273 combiner
VNG1816G 273 tf
VNG6288C 273 tf
VNG1377G
VNG6288C
257 combiner
VNG1510C
VNG6288C
257 combiner
VNG5176C
VNG6288C
257 combiner
VNG6143H 257 tf
Regulated by VNG1405C (15)
Module Residual Genes
9 0.49 32
84 0.41 28
125 0.36 20
139 0.33 17
163 0.45 30
174 0.49 31
205 0.51 30
208 0.37 29
209 0.34 23
223 0.39 30
227 0.47 28
238 0.43 7
244 0.43 30
289 0.33 15
298 0.36 28
Motif information (de novo identified motifs for modules)

There are 10 motifs predicted.

Motif Table (10)
Motif Id e-value Consensus Motif Logo
1001 0.00e+00 acAccCAAacacaTgGgGgaTcgG
Loader icon
1002 5.00e-04 AAAttGATTGcgtcctgtaGtta
Loader icon
1121 1.40e-05 AaCACCCAAACacATggGGtaT
Loader icon
1122 1.10e-03 aaa.tGatTgggtgcTataGtTac
Loader icon
1267 6.30e-01 AcGcCgaCgaC
Loader icon
1268 4.20e+01 AAAGACACATAAATAAGCGT
Loader icon
1447 8.50e-01 CcAccTatTCGCCgAgtAtcA
Loader icon
1448 2.30e+00 AAAAGAGTTACGAATTTCGTAACT
Loader icon
1479 0.00e+00 atcCcCaatgag.ttGggtgtT.t
Loader icon
1480 5.80e-03 aggCCCcAAtCAATcTggTa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG1405C

VNG1405C is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Predicted transcriptional regulators cog/ cog
Module neighborhood information for VNG1405C

VNG1405C has total of 61 gene neighbors in modules 11, 73, 151, 257, 273
Gene neighbors (61)
Gene Common Name Description Module membership
VNG0284C hypothetical protein VNG0284C 118, 151
VNG0314G aroD 3-dehydroquinate dehydratase 118, 151
VNG0402H hypothetical protein VNG0402H 73, 84
VNG0430H hypothetical protein VNG0430H 42, 68, 151
VNG0462C hypothetical protein VNG0462C 42, 57, 68, 151, 162, 246
VNG0654C hypothetical protein VNG0654C 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0656H hypothetical protein VNG0656H 11, 73, 208, 223, 244, 273
VNG0737H hypothetical protein VNG0737H 9, 244, 273
VNG0761G dip3 competence-damage protein CinA-like 44, 151, 214
VNG0799C hypothetical protein VNG0799C 118, 151
VNG0828H hypothetical protein VNG0828H 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289
VNG0829G dmsA dimethylsulfoxide reductase 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289
VNG0830G hmoA HmoA 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0831G moz molybdopterin oxidoreductase 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0832C hypothetical protein VNG0832C 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0928G mak MAPK-activated protein kinase 151, 257
VNG0997G acs2 acetyl-CoA synthetase 9, 73, 84
VNG1039H hypothetical protein VNG1039H 11, 73, 244, 273
VNG1083G menF isochorismate synthase 273, 284
VNG1121G aspC2 aspartate aminotransferase 73, 125, 223
VNG1200H hypothetical protein VNG1200H 9, 73, 84, 223, 244
VNG1370G btuC corrinoid ABC transporter permease 11, 95, 104
VNG1380H hypothetical protein VNG1380H 9, 73, 84, 223
VNG1405C hypothetical protein VNG1405C 11, 73, 151, 257, 273
VNG1431C hypothetical protein VNG1431C 151
VNG1440H hypothetical protein VNG1440H 151
VNG1444G hisD histidinol dehydrogenase 151, 176
VNG1450G yfkN 2',3'-cyclic-nucleotide 2'-phosphodiesterase 46, 151, 173
VNG1458G crtB1 phytoene synthase 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1459H hypothetical protein VNG1459H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1461H hypothetical protein VNG1461H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1462G cdc48a cell division cycle protein 9, 11, 73, 84, 125, 208, 223, 244, 273
VNG1463G blp bacterio-opsin linked protein 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1464G bat bacterio-opsin activator 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1465G brp bacteriorhodopsin-like protein 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1467G bop bacterio-opsin 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1468H hypothetical protein VNG1468H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1544G clc chloride channel 146, 273
VNG1628G aad aryl-alcohol dehydrogenase 11, 208, 244, 273
VNG1630H hypothetical protein VNG1630H 11, 208, 244, 273
VNG1655H hypothetical protein VNG1655H 11
VNG1656H hypothetical protein VNG1656H 11, 208, 273
VNG1657H hypothetical protein VNG1657H 11, 208, 244, 273
VNG1754G phr1 photolyase/cryptochrome 208, 223, 273
VNG1755G crtI2 phytoene dehydrogenase 11, 208, 223, 273
VNG1815G carA carbamoyl phosphate synthase small subunit 68, 86, 209, 257, 294, 298
VNG1816G trh3 transcription regulator 68, 86, 139, 209, 238, 257, 298
VNG1818G idi Idi 68, 86, 209, 214, 234, 257
VNG1826H hypothetical protein VNG1826H 9, 73
VNG1848H hypothetical protein VNG1848H 151
VNG1882G nadA quinolinate synthetase 11, 208, 223, 273
VNG1883G nadB L-aspartate oxidase 11, 73, 125, 208, 223, 244, 273
VNG1884G nadC hypothetical protein VNG1884G 11, 73, 125, 208, 223, 244, 273
VNG2012C hypothetical protein VNG2012C 257, 259
VNG2014H hypothetical protein VNG2014H 9, 73, 208, 223
VNG2137G ggt geranylgeranyl-diphosphate geranylgeranyltransferase 11, 208, 244, 273
VNG2199H hypothetical protein VNG2199H 73
VNG2335H hypothetical protein VNG2335H 57, 86, 106, 139, 209, 257, 298
VNG2535H hypothetical protein VNG2535H 9, 11, 73, 125, 208, 223, 244, 273
VNG7056 hypothetical protein VNG7056 86, 105, 106, 186, 209, 232, 238, 243, 257, 298
VNG7127 hypothetical protein VNG7127 86, 106, 209, 257, 298
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG1405C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend