Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6346H

hypothetical protein VNG6346H

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6346H
(Mouseover regulator name to see its description)

VNG6346H is regulated by 18 influences and regulates 0 modules.
Regulators for VNG6346H (18)
Regulator Module Operator
VNG1237C 117 tf
VNG1510C 117 tf
VNG2112C 117 tf
VNG6143H 117 tf
VNG0247C 196 tf
VNG1237C 196 tf
VNG1510C 196 tf
VNG1786H 196 tf
VNG2112C 196 tf
VNG1215G
VNG1886C
219 combiner
VNG1215G
VNG6143H
219 combiner
VNG1215G
VNG6193H
219 combiner
VNG6193H 219 tf
VNG1508C 176 tf
VNG1548C 176 tf
VNG6389G 176 tf
VNG6438G 176 tf
VNG6438G
VNG0389C
176 combiner

Warning: VNG6346H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
1207 2.60e-01 tTTaaat.tcTaTCt
Loader icon
1208 8.70e-01 aGAt.gActTaGAGtTcgtcgAAC
Loader icon
1311 3.80e-03 TgATTTATcTaTCTgTC
Loader icon
1312 4.80e+00 AAACGGTGATACTGAAGGCCAGTT
Loader icon
1347 1.60e-01 GTttTaaaTtaggaGattgAt
Loader icon
1348 1.10e+02 Ctttg.tgccTGTG
Loader icon
1383 4.10e-02 ATtAAttaGGAGgTTGAG
Loader icon
1384 1.70e+02 CAgGGATCA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6346H

Warning: No Functional annotations were found!

Module neighborhood information for VNG6346H

VNG6346H has total of 40 gene neighbors in modules 117, 176, 196, 219
Gene neighbors (40)
Gene Common Name Description Module membership
VNG0045C hypothetical protein VNG0045C 196, 265
VNG0050C hypothetical protein VNG0050C 196, 233
VNG0119H hypothetical protein VNG0119H 117, 264
VNG0121H hypothetical protein VNG0121H 117, 268
VNG0139H hypothetical protein VNG0139H 17, 18, 30, 196
VNG0148H hypothetical protein VNG0148H 41, 80, 171, 189, 196, 219, 224
VNG0149G zntA hypothetical protein VNG0149G 171, 189, 196, 219, 224
VNG0511H hypothetical protein VNG0511H 196
VNG0512G ppe DNA double-strand break repair protein 18, 121, 177, 196
VNG0514C chromosome segregation protein 190, 196
VNG0624H hypothetical protein VNG0624H 117
VNG0652H hypothetical protein VNG0652H 117
VNG0736G kinA2 signal-transducing histidine kinase-like protein 117
VNG1179C hypothetical protein VNG1179C 117, 285
VNG1239H hypothetical protein VNG1239H 117, 230
VNG1300H hypothetical protein VNG1300H 117, 285
VNG1444G hisD histidinol dehydrogenase 151, 176
VNG1576G cbiP cobyric acid synthase 117, 210
VNG1641H hypothetical protein VNG1641H 117, 300
VNG1832H hypothetical protein VNG1832H 117
VNG1978H hypothetical protein VNG1978H 117, 213
VNG2075C hypothetical protein VNG2075C 117
VNG2159Gm manC mannose-1-phosphate guanylyltransferase 117
VNG2315H hypothetical protein VNG2315H 117
VNG2404G dip1 DNA damage-inducible protein 117
VNG2566H hypothetical protein VNG2566H 117, 288
VNG2569H hypothetical protein VNG2569H 117
VNG5048H None 117, 213
VNG5112H None 117, 279
VNG6166H hypothetical protein VNG6166H 117
VNG6323H hypothetical protein VNG6323H 117, 168, 178
VNG6326G trp6 daunorubicin resistance ABC transporter ATP-binding protein 117, 201, 224
VNG6346H hypothetical protein VNG6346H 117, 176, 196, 219
VNG6347H hypothetical protein VNG6347H 176
VNG6373G phrH PhiH1 repressor-like protein 107, 117
VNG6387H hypothetical protein VNG6387H 117, 297
VNG6429H hypothetical protein VNG6429H 117
VNG6430C hypothetical protein VNG6430C 117
VNG7095 repI replication protein RepI 117
VNG7108 hypothetical protein VNG7108 117, 147
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6346H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend