Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6368H

hypothetical protein VNG6368H

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6368H
(Mouseover regulator name to see its description)

VNG6368H is regulated by 9 influences and regulates 0 modules.
Regulators for VNG6368H (9)
Regulator Module Operator
VNG1237C 279 tf
VNG1510C 279 tf
VNG6143H 279 tf
VNG1510C 116 tf
VNG1510C
VNG6288C
116 combiner
VNG5068G
VNG0835G
116 combiner
VNG6143H 116 tf
KO_1_VNG_VNG0716G 272 ef
VNG6143H 272 tf

Warning: VNG6368H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 6 motifs predicted.

Motif Table (6)
Motif Id e-value Consensus Motif Logo
1205 1.60e+01 CggtccgtGaGcaCCt.CAgc
Loader icon
1206 1.70e+03 cGgCgGTGTGT
Loader icon
1477 6.30e-01 ATAGTAAGTTCCAATTGGGAAATA
Loader icon
1478 1.00e+00 GATcTGaGaTAAGttCgGaA
Loader icon
1487 1.10e+02 AGAgAA
Loader icon
1488 1.40e+02 aac.cgT.c.AATCgg.gaa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6368H

Warning: No Functional annotations were found!

Module neighborhood information for VNG6368H

VNG6368H has total of 43 gene neighbors in modules 116, 272, 279
Gene neighbors (43)
Gene Common Name Description Module membership
VNG0108G rmeR RmeR 116, 247, 254
VNG0154G merA mercury(II) reductase 116, 268
VNG0427G yfmO2 multidrug resistance protein-like protein 116
VNG0542C hypothetical protein VNG0542C 116
VNG0590H hypothetical protein VNG0590H 116, 284
VNG0688H hypothetical protein VNG0688H 116
VNG0694G nthB hypothetical protein VNG0694G 116
VNG1042H hypothetical protein VNG1042H 116, 284
VNG1162H hypothetical protein VNG1162H 116, 282
VNG1191Gm ACD3 Acyl-CoA dehydrogenase 116, 285
VNG1237C hypothetical protein VNG1237C 116, 131
VNG1513H hypothetical protein VNG1513H 116
VNG1519H hypothetical protein VNG1519H 116
VNG1528G nac sodium- and chloride-dependent transporter 116
VNG1547C hypothetical protein VNG1547C 116
VNG1592G cysT2 sulfate transport system permease 116, 300
VNG1621H hypothetical protein VNG1621H 116
VNG1623G ccp heme A synthase 116
VNG1665G radB DNA repair and recombination protein RadB 116
VNG1686G mch N5,N10-methenyltetrahydromethanopterin cyclohydrolase 116
VNG1951G sub subtilisin-like serine protease 116
VNG2079G mutT hypothetical protein VNG2079G 116
VNG2080C hypothetical protein VNG2080C 116, 162
VNG2130G minD2 hypothetical protein VNG2130G 116
VNG2152C hypothetical protein VNG2152C 116, 186
VNG2272G rpi ribose-5-phosphate isomerase A 116
VNG2421G hal O-acetyl homoserine 116
VNG2474C hypothetical protein VNG2474C 48, 279
VNG2475C hypothetical protein VNG2475C 48, 256, 279
VNG2521H hypothetical protein VNG2521H 116
VNG5112H None 117, 279
VNG6152H hypothetical protein VNG6152H 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6368H hypothetical protein VNG6368H 116, 272, 279
VNG6370H hypothetical protein VNG6370H 272
VNG6371G mrr Mrr restriction system protein-like protein 47, 272, 279
VNG6403H hypothetical protein VNG6403H 116, 299
VNG7074 hypothetical protein VNG7074 135, 256, 279, 292
VNG7075 hypothetical protein VNG7075 87, 250, 279, 292
VNG7076 hypothetical protein VNG7076 252, 256, 276, 279
VNG7077 hypothetical protein VNG7077 87, 250, 276, 279
VNG7134 hypothetical protein VNG7134 183, 272
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6368H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend