Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6152H

hypothetical protein VNG6152H

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6152H
(Mouseover regulator name to see its description)

VNG6152H is regulated by 41 influences and regulates 0 modules.
Regulators for VNG6152H (41)
Regulator Module Operator
VNG2112C 37 tf
VNG6143H 37 tf
VNG1179C 189 tf
VNG2112C 189 tf
VNG6143H 189 tf
VNG6389G 189 tf
KO_1_VNG_VNG0716G 272 ef
VNG6143H 272 tf
VNG1179C 142 tf
VNG1237C 142 tf
VNG1786H 142 tf
VNG2579G
VNG0389C
142 combiner
VNG6143H 142 tf
VNG1548C 31 tf
VNG2112C 31 tf
VNG6389G 31 tf
VNG6438G
VNG6288C
31 combiner
VNG1179C 281 tf
VNG1237C 281 tf
VNG1886C 281 tf
VNG2112C 281 tf
VNG6143H 281 tf
VNG6438G 281 tf
VNG1237C 297 tf
VNG2112C 297 tf
VNG5068G
VNG1886C
297 combiner
VNG5163G 297 tf
VNG1179C 15 tf
VNG1237C 15 tf
VNG6143H 15 tf
VNG1237C 4 tf
VNG2112C 4 tf
VNG6143H 4 tf
VNG1510C 26 tf
VNG1548C 26 tf
VNG6389G 26 tf
VNG1237C 13 tf
VNG2112C 13 tf
VNG6143H 13 tf
VNG6287H 13 tf
VNG6438G 13 tf

Warning: VNG6152H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 22 motifs predicted.

Motif Table (22)
Motif Id e-value Consensus Motif Logo
987 3.00e-03 aAaAc.Acg.cCtagctaaaatAa
Loader icon
988 8.90e-01 GtCTTggGCGAaTaGAAAtCTTCt
Loader icon
1005 1.20e+01 CGaccgagagGAacgcgtGGA
Loader icon
1006 8.20e+00 GTtTGAgGTGcgtGAcACGATTC
Loader icon
1009 1.40e-04 AAATatAAAtaAgat
Loader icon
1010 2.50e-03 AaGtctAtTttgAGtgAAtGggA
Loader icon
1029 2.30e-02 gtTtcAgcaccGgcTctGaATagA
Loader icon
1030 6.00e-03 atACtcttACaaagATAAAgaaGg
Loader icon
1039 2.20e-03 gAcAtc.A..AacaA
Loader icon
1040 7.70e+02 aATATAAa
Loader icon
1051 7.00e-06 AaAtagatatgAttg.aataT
Loader icon
1052 5.70e+01 AaGa.ATT
Loader icon
1255 8.60e+01 AcaAAaaGcGATT
Loader icon
1256 1.20e+02 tacataaagaAGaTT
Loader icon
1333 2.00e-02 aaTtAggaggtTGacacgctgCGt
Loader icon
1334 3.90e+00 atcgtccagGcgtTCct.tCggTC
Loader icon
1477 6.30e-01 ATAGTAAGTTCCAATTGGGAAATA
Loader icon
1478 1.00e+00 GATcTGaGaTAAGttCgGaA
Loader icon
1491 2.00e+00 aAAatGtgTaTG
Loader icon
1492 4.30e+03 ATcaTCTGAAT
Loader icon
1515 6.20e-03 cTTCgtAttaTagttATCt
Loader icon
1516 4.00e+01 aaAGtAtT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6152H

Warning: No Functional annotations were found!

Module neighborhood information for VNG6152H

VNG6152H has total of 100 gene neighbors in modules 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
Gene neighbors (100)
Gene Common Name Description Module membership
VNG0027H hypothetical protein VNG0027H 26, 31, 72, 232, 243
VNG0055H hypothetical protein VNG0055H 37, 41, 183, 185
VNG0057H hypothetical protein VNG0057H 26, 254
VNG0140H hypothetical protein VNG0140H 18, 26, 30, 239
VNG0148H hypothetical protein VNG0148H 41, 80, 171, 189, 196, 219, 224
VNG0149G zntA hypothetical protein VNG0149G 171, 189, 196, 219, 224
VNG0196H hypothetical protein VNG0196H 30, 267, 281
VNG0216H hypothetical protein VNG0216H 4, 13, 15, 20, 32, 43, 92, 93, 94, 103, 104, 105
VNG0217H hypothetical protein VNG0217H 13, 15, 20, 32, 43, 53, 92, 93, 94, 103, 105
VNG0396C hypothetical protein VNG0396C 26, 57, 243
VNG0573C hypothetical protein VNG0573C 4, 5, 26, 28
VNG0612H hypothetical protein VNG0612H 26, 243
VNG0825C hypothetical protein VNG0825C 4, 5, 32, 43
VNG0883H hypothetical protein VNG0883H 5, 26
VNG0936C hypothetical protein VNG0936C 142
VNG0985H hypothetical protein VNG0985H 4, 5, 164
VNG0987H hypothetical protein VNG0987H 142, 202, 277
VNG0993H hypothetical protein VNG0993H 37, 188
VNG1000H hypothetical protein VNG1000H 20, 26, 31, 232
VNG1064H hypothetical protein VNG1064H 17, 37, 96, 108
VNG1066C hypothetical protein VNG1066C 13, 96, 102, 108
VNG1270H hypothetical protein VNG1270H 18, 30, 37, 42
VNG1271H hypothetical protein VNG1271H 18, 30, 37
VNG1395G htr9 Htr9 13, 60, 281
VNG1429C 2-phospho-L-lactate transferase 31, 232, 243
VNG1453H hypothetical protein VNG1453H 4, 28
VNG1455H hypothetical protein VNG1455H 26, 31, 57, 86
VNG1520G mutY A/G specific adenine glycosylase, repair protein 4, 5, 53
VNG1589C hypothetical protein VNG1589C 4, 5, 8, 28, 69, 85, 204
VNG1590H hypothetical protein VNG1590H 13, 281
VNG1648G trpF hypothetical protein VNG1648G 4, 5, 28, 30, 48, 64, 87
VNG1650H hypothetical protein VNG1650H 4, 5, 30, 34, 35, 245, 295
VNG1681C hypothetical protein VNG1681C 20, 26, 28, 31, 147, 232
VNG1918C geranylgeranylglyceryl phosphate synthase-like protein 13, 20, 53, 60
VNG1953C hypothetical protein VNG1953C 13, 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1976H hypothetical protein VNG1976H 26, 31, 60
VNG1986C hypothetical protein VNG1986C 17, 26, 30, 31, 108
VNG2002H hypothetical protein VNG2002H 26, 232
VNG2096G cctB thermosome subunit beta 4, 5, 28, 53, 140, 173
VNG2100G iluA threonine dehydratase 5, 20, 26, 28
VNG2174H hypothetical protein VNG2174H 34, 38, 297
VNG2386C hypothetical protein VNG2386C 13, 28
VNG2444C hypothetical protein VNG2444C 17, 28, 31, 38, 173
VNG2466C None 13, 31, 64, 70, 166
VNG5047H None 15, 18, 63
VNG5073H None 13
VNG5120H None 18, 37, 198
VNG5157H None 37
VNG6005H hypothetical protein VNG6005H 37, 198
VNG6143H hypothetical protein VNG6143H 5, 26, 31, 72, 86, 106, 204, 232, 243, 295, 298
VNG6144G trsE transfer complex protein 4, 5, 42, 68, 295
VNG6145H hypothetical protein VNG6145H 31, 72, 86, 106, 232, 298
VNG6150G orc1 orc / cell division control protein 6 4, 13, 38, 142, 189
VNG6152H hypothetical protein VNG6152H 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
VNG6153G sojC2 Spo0A activation inhibitor 297
VNG6159H hypothetical protein VNG6159H 297
VNG6170H hypothetical protein VNG6170H 4, 5, 15, 26, 28, 31, 36, 53, 60, 63, 69, 72, 85, 122
VNG6175G trkA2 TRK potassium uptake system protein 5, 15, 62, 69, 72, 177
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6177G kdpB potassium-transporting ATPase subunit B 5, 15, 62, 63, 69, 72
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6180H hypothetical protein VNG6180H 37
VNG6183C hypothetical protein VNG6183C 15, 18, 213
VNG6184G cat4 cationic amino acid transporter 15, 18, 213
VNG6185H hypothetical protein VNG6185H 15, 18, 213
VNG6186H hypothetical protein VNG6186H 15, 18, 213
VNG6198H hypothetical protein VNG6198H 31
VNG6230G gvpK2 GvpK protein, cluster B 4, 5, 8, 22, 28, 31, 141, 148, 181, 182, 188, 200
VNG6232G gvpJ2 GvpJ protein, cluster B 4, 5, 8, 28, 31, 42, 141, 148, 182, 188
VNG6233G gvpI2 GvpI protein, cluster B 31, 141, 188
VNG6235G gvpH2 GvpH protein, cluster B 31, 42, 141, 188
VNG6239G gvpE2 GvpE protein, cluster B 4, 5, 8, 28, 141, 148, 182, 188, 200
VNG6244G gvpN2 GvpN protein, cluster B 5, 26, 53, 185
VNG6266H hypothetical protein VNG6266H 31, 146
VNG6339H hypothetical protein VNG6339H 26, 31, 69, 86, 106, 204, 232
VNG6364H hypothetical protein VNG6364H 31, 106
VNG6367H hypothetical protein VNG6367H 47, 142
VNG6368H hypothetical protein VNG6368H 116, 272, 279
VNG6370H hypothetical protein VNG6370H 272
VNG6371G mrr Mrr restriction system protein-like protein 47, 272, 279
VNG6375H hypothetical protein VNG6375H 13, 60, 121, 189
VNG6377H hypothetical protein VNG6377H 13, 60, 121, 189
VNG6378H hypothetical protein VNG6378H 13, 21, 53, 60, 121, 189, 281
VNG6383G lctP L-lactate permease 8, 13, 14
VNG6385H hypothetical protein VNG6385H 265, 297
VNG6387H hypothetical protein VNG6387H 117, 297
VNG6390H hypothetical protein VNG6390H 4, 26, 30, 34, 35, 245, 295
VNG6416H hypothetical protein VNG6416H 13, 15, 21, 41, 60, 281
VNG6418H hypothetical protein VNG6418H 13, 18, 21, 41, 60, 281
VNG6419H hypothetical protein VNG6419H 13, 21, 60, 281
VNG6424H hypothetical protein VNG6424H 13, 15, 189
VNG6431H hypothetical protein VNG6431H 17, 26, 30, 38, 178
VNG6432H hypothetical protein VNG6432H 17, 26, 31, 38, 106, 243
VNG6439H hypothetical protein VNG6439H 26, 31, 243
VNG7046 hypothetical protein VNG7046 13, 212, 216
VNG7052 hypothetical protein VNG7052 13
VNG7107 putative ISH4 transposase 37, 147
VNG7109 hypothetical protein VNG7109 4, 18, 38, 91
VNG7128 hypothetical protein VNG7128 21, 60, 281
VNG7134 hypothetical protein VNG7134 183, 272
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6152H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend