Organism : Pseudomonas aeruginosa | Module List :
PA1895

hypothetical protein (NCBI)

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for PA1895
(Mouseover regulator name to see its description)

PA1895 is regulated by 33 influences and regulates 0 modules.
Regulators for PA1895 (33)
Regulator Module Operator
PA0367 473 tf
PA0376 473 tf
PA1455 473 tf
PA1663 473 tf
PA1898 473 tf
PA2320 473 tf
PA3341 473 tf
PA3420 473 tf
PA3879 473 tf
PA4057 473 tf
PA4275 473 tf
PA4769 473 tf
PA5157 473 tf
PA5356 473 tf
PA1300 411 tf
PA1859 411 tf
PA1898 411 tf
PA2802 411 tf
PA2848 411 tf
PA3006 411 tf
PA3007 411 tf
PA3285 411 tf
PA3341 411 tf
PA3363 411 tf
PA3364 411 tf
PA3596 411 tf
PA3689 411 tf
PA4354 411 tf
PA4764 411 tf
PA4769 411 tf
PA5059 411 tf
PA5105 411 tf
PA5356 411 tf

Warning: PA1895 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
3646 1.20e+01 GTctAACtGgTCCtaCCaGTA
Loader icon
3647 1.50e+02 ACTTTCTAGCATGCGCCTCAT
Loader icon
3762 3.60e-08 A.aAtttTttcaatAcacTtt
Loader icon
3763 5.40e-04 atCaacaagaA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for PA1895

Warning: No Functional annotations were found!

Module neighborhood information for PA1895

PA1895 has total of 44 gene neighbors in modules 411, 473
Gene neighbors (44)
Gene Common Name Description Module membership
PA0221 PA0221 probable aminotransferase (NCBI) 425, 473
PA1168 PA1168 hypothetical protein (NCBI) 34, 473
PA1169 PA1169 probable lipoxygenase (NCBI) 104, 473
PA1213 PA1213 hypothetical protein (NCBI) 411, 472
PA1214 PA1214 hypothetical protein (NCBI) 411, 472
PA1215 PA1215 hypothetical protein (NCBI) 411, 472
PA1216 PA1216 hypothetical protein (NCBI) 411, 472
PA1217 PA1217 probable 2-isopropylmalate synthase (NCBI) 411, 472
PA1218 PA1218 hypothetical protein (NCBI) 411, 472
PA1221 PA1221 hypothetical protein (NCBI) 411, 472
PA1892 PA1892 hypothetical protein (NCBI) 197, 473
PA1893 PA1893 hypothetical protein (NCBI) 197, 473
PA1894 PA1894 hypothetical protein (NCBI) 411, 473
PA1895 PA1895 hypothetical protein (NCBI) 411, 473
PA1896 PA1896 hypothetical protein (NCBI) 411, 473
PA1897 PA1897 hypothetical protein (NCBI) 411, 473
PA2680 PA2680 probable quinone oxidoreductase (NCBI) 190, 473
PA3039 PA3039 probable transporter (NCBI) 473, 475
PA3488 PA3488 hypothetical protein (NCBI) 293, 473
PA3515 PA3515 hypothetical protein (NCBI) 407, 473
PA3519 PA3519 hypothetical protein (NCBI) 407, 473
PA4142 PA4142 probable secretion protein (NCBI) 112, 473
PA4143 PA4143 probable toxin transporter (NCBI) 112, 473
PA4144 PA4144 probable outer membrane protein precursor (NCBI) 112, 473
PA4513 PA4513 probable oxidoreductase (NCBI) 173, 473
PA4514 PA4514 probable outer membrane receptor for iron transport (NCBI) 98, 473
PA4515 PA4515 putative hydroxylase (NCBI) 98, 473
PA4516 PA4516 hypothetical protein (NCBI) 98, 473
PA4650 PA4650 hypothetical protein (NCBI) 392, 473
PA4652 PA4652 hypothetical protein (NCBI) 401, 473
PA4869 PA4869 hypothetical protein (NCBI) 26, 473
PA5087 PA5087 hypothetical protein (NCBI) 231, 473
PA5089 PA5089 hypothetical protein (NCBI) 241, 473
PA5090 PA5090 hypothetical protein (NCBI) 439, 473
PA5157 PA5157 probable transcriptional regulator (NCBI) 212, 473
PA5158 PA5158 probable outer membrane protein precursor (NCBI) 53, 473
PA5159 PA5159 multidrug resistance protein (NCBI) 20, 473
PA5160 PA5160 drug efflux transporter (NCBI) 366, 473
PA5205 PA5205 hypothetical protein (NCBI) 246, 473
PA5352 PA5352 hypothetical protein (NCBI) 305, 411
PA5353 glcF glycolate oxidase subunit GlcF (NCBI) 305, 411
PA5354 glcE glycolate oxidase subunit GlcE (NCBI) 305, 411
PA5355 glcD glycolate oxidase subunit GlcD (NCBI) 305, 411
PA5356 glcC transcriptional regulator GlcC (NCBI) 305, 411
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for PA1895
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend