Organism : Rhodobacter sphaeroides 2.4.1 | Module List :
RSP_0680 hemE

Uroporphyrinogen decarboxylase (NCBI)

CircVis
Functional Annotations (7)
Function System
Uroporphyrinogen-III decarboxylase cog/ cog
uroporphyrinogen decarboxylase activity go/ molecular_function
porphyrin-containing compound biosynthetic process go/ biological_process
Porphyrin and chlorophyll metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
hemE tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for RSP_0680
(Mouseover regulator name to see its description)

RSP_0680 is regulated by 17 influences and regulates 0 modules.
Regulators for RSP_0680 hemE (17)
Regulator Module Operator
RSP_0547 163 tf
RSP_1518 163 tf
RSP_2346 163 tf
RSP_2572 163 tf
RSP_2606 163 tf
RSP_2800 163 tf
RSP_2888 163 tf
RSP_3238 163 tf
RSP_0443 139 tf
RSP_0527 139 tf
RSP_0623 139 tf
RSP_1518 139 tf
RSP_2346 139 tf
RSP_2572 139 tf
RSP_2888 139 tf
RSP_2963 139 tf
RSP_3238 139 tf

Warning: RSP_0680 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7998 6.90e+00 AgCATGGgaTGtCAaTAtG
Loader icon
7999 1.90e+02 AAATGGACAGCGCTAACCAAAT
Loader icon
8046 9.00e-05 atttTcgcaAgcgGaGCg
Loader icon
8047 7.50e-02 CaAtTttc.cTgACA.ct.ctc.t
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for RSP_0680

RSP_0680 is enriched for 7 functions in 3 categories.
Enrichment Table (7)
Function System
Uroporphyrinogen-III decarboxylase cog/ cog
uroporphyrinogen decarboxylase activity go/ molecular_function
porphyrin-containing compound biosynthetic process go/ biological_process
Porphyrin and chlorophyll metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
hemE tigr/ tigrfam
Module neighborhood information for RSP_0680

RSP_0680 has total of 31 gene neighbors in modules 139, 163
Gene neighbors (31)
Gene Common Name Description Module membership
RSP_0112 nuoN NADH-ubiquinone oxidoreductase, chain 4 (NCBI) 163, 283
RSP_0228 hmuS putative hemin transport protein (NCBI) 139, 163
RSP_0238 RSP_0238 hypothetical transmembrane protein (NCBI) 144, 163
RSP_0241 RSP_0241 Putative protein-S-isoprenylcysteine methyltransferase (NCBI) 139, 163
RSP_0266 crtD Methoxyneurosporene dehydrogenase (NCBI) 8, 163
RSP_0267 ctrC Hydroxyneurosporene dehydrogenase (NCBI) 8, 163
RSP_0275 bchO Magnesium-chelatase, BchO (NCBI) 139, 163
RSP_0283 ppaA regulatory protein, PpaA (NCBI) 163, 382
RSP_0285 bchN light-independent protochlorophyllide reductase (NCBI) 18, 163
RSP_0294 RSP_0294 hypothetical protein (NCBI) 163, 330
RSP_0295 RSP_0295 hypothetical protein (NCBI) 163, 330
RSP_0315 pucC Light-harvesting 1 (B870) complex assembly (NCBI) 45, 163
RSP_0428 RSP_0428 hypothetical protein (NCBI) 27, 163
RSP_0527 rpoN sigma-54, RpoN (NCBI) 36, 139
RSP_0547 nifA NifA transcriptional activator (NCBI) 27, 139
RSP_0580 RSP_0580 Putative sulfate transporter, SulP family (NCBI) 144, 163
RSP_0581 RSP_0581 hypothetical protein (NCBI) 157, 163
RSP_0660 RSP_0660 hypothetical protein (NCBI) 49, 139
RSP_0679 hemC Porphobilinogen deaminase (NCBI) 139, 163
RSP_0680 hemE Uroporphyrinogen decarboxylase (NCBI) 139, 163
RSP_1565 appA AppA, antirepressor of ppsR, sensor of blue light (NCBI) 139, 358
RSP_2087 RSP_2087 hypothetical protein (NCBI) 45, 139
RSP_2572 crpK crpK, Fnr-type transcriptional regulator (NCBI) 139, 163
RSP_2573 RSP_2573 hypothetical protein (NCBI) 139, 377
RSP_2830 RSP_2830 hypothetical protein (NCBI) 92, 139
RSP_2831 cobO Probable cob(I)alamin adenosyltransferase (NCBI) 92, 163
RSP_2858 RSP_2858 IndA involved in pigment biosynthesis (NCBI) 36, 139
RSP_2888 RSP_2888 Transcriptional regulator (NCBI) 163, 382
RSP_2963 RSP_2963 transcriptional regulator, Crp-Fnr family (NCBI) 85, 139
RSP_3638 RSP_3638 hypothetical protein (NCBI) 27, 139
RSP_3825 RSP_3825 hypothetical protein (NCBI) 49, 139
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for RSP_0680
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend